• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Betula Platyphylla


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GCGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGTGAACCTGTTGAAACAACTGGGGGTGTGGGGCGATCTCGCCCCTTGCCCCCGAACGGTAGGGAGACACTTGTGCATCCCTGCCGAACAACGAACCCCGGCGCGGTCCGCGCCAAGGAACTTTAACGAAAGAGTGCCTCCGGCCGCCTCGGAAACGGTGTGCGTGCGGGAGGTGAATCTTGTCTAGAACCATAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGTTGCCCCCAACCCCATCTCCTTGCAAAGGGACGAGGGGGCCTGTGGGGCAGAAATTGGCCTCCCGTGAGCTCATGCATGCGGTTGGCCTAAAAGCGAGTCCTCGGCGACGCGCGCCACGACAATCGGTGGTTGTCAAACCCTCGTGTCCCGTCGTGCGTGCCGCGTCGCTCATCGTGTGCTCCTTGACCCTGTTGTGTCGCGCTAGCGACGCTTCCA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO4138
Plant Latin Name: Betula Platyphylla
Taxonomy Genus: Betula
Taxonomy Family: Betulaceae

Plant External Links:

NCBI TaxonomyDB: 78630
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM


Medicinal Functions:

Antifungal; Antiinflammatory; Antiseborrheic; Cancer; Tonic

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

89 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


46 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

60 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9860

Ingredient ID: NPC97231

Ingredient ID: NPC95615

Ingredient ID: NPC86747

Ingredient ID: NPC83341

Ingredient ID: NPC80466

Ingredient ID: NPC76871

Ingredient ID: NPC73517

Ingredient ID: NPC72649

Ingredient ID: NPC70744

Ingredient ID: NPC66764

Ingredient ID: NPC66586

Ingredient ID: NPC60249

Ingredient ID: NPC55098

Ingredient ID: NPC51809

Ingredient ID: NPC49302

Ingredient ID: NPC48309

Ingredient ID: NPC469696

Ingredient ID: NPC469687

Ingredient ID: NPC469686

Ingredient ID: NPC469549

Ingredient ID: NPC469548

Ingredient ID: NPC44596

Ingredient ID: NPC39351

Ingredient ID: NPC34103

Ingredient ID: NPC33868

Ingredient ID: NPC326623

Ingredient ID: NPC325473

Ingredient ID: NPC317480

Ingredient ID: NPC29989

Ingredient ID: NPC29883

Ingredient ID: NPC294282

Ingredient ID: NPC286770

Ingredient ID: NPC284472

Ingredient ID: NPC27739

Ingredient ID: NPC274613

Ingredient ID: NPC263717

Ingredient ID: NPC259182

Ingredient ID: NPC257124

Ingredient ID: NPC253948

Ingredient ID: NPC244749

Ingredient ID: NPC244046

Ingredient ID: NPC243728

Ingredient ID: NPC232454

Ingredient ID: NPC230301

Ingredient ID: NPC226231

Ingredient ID: NPC225665

Ingredient ID: NPC223476

Ingredient ID: NPC219913

Ingredient ID: NPC219876

Ingredient ID: NPC216630

Ingredient ID: NPC210453

Ingredient ID: NPC209970

Ingredient ID: NPC206289

Ingredient ID: NPC203719

Ingredient ID: NPC199335

Ingredient ID: NPC196866

Ingredient ID: NPC193695

Ingredient ID: NPC192638

Ingredient ID: NPC186777

Ingredient ID: NPC186632

Ingredient ID: NPC186098

Ingredient ID: NPC181465

Ingredient ID: NPC17968

Ingredient ID: NPC178383

Ingredient ID: NPC177576

Ingredient ID: NPC171928

Ingredient ID: NPC169248

Ingredient ID: NPC16279

Ingredient ID: NPC158088

Ingredient ID: NPC156353

Ingredient ID: NPC151879

Ingredient ID: NPC148055

Ingredient ID: NPC147743

Ingredient ID: NPC138117

Ingredient ID: NPC133671

Ingredient ID: NPC132078

Ingredient ID: NPC126029

Ingredient ID: NPC123965

Ingredient ID: NPC119949

Ingredient ID: NPC113733

Ingredient ID: NPC111929

Ingredient ID: NPC111888

Ingredient ID: NPC111618

Ingredient ID: NPC110899

Ingredient ID: NPC110150

Ingredient ID: NPC109813

Ingredient ID: NPC107070

Ingredient ID: NPC106511