• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Geranium Sylvaticum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

GCTCCGTCGCCCCGCAACCCCGAACCCCGAAACGGGCCAGGGCGCTTGTGGTGCGGACATTGGTCTCCCGTGTGCCTTGCTCGCGGCTGGCCTAAAATTGAGTCCCGGACGCTCTGTTCTGCGGCCGACGGTGGTTGAGAAGCCCTCGAAAATGCGCCGCTGCAGTGCTGCCCGATATGGACCCTCTGACCCTTGCGTGACCTCTCCCATTTGGGTGAGGGAGCTCCAT
Taxonomic Information

Plant ID: NPO4073
Plant Latin Name: Geranium Sylvaticum
Taxonomy Genus: Geranium
Taxonomy Family: Geraniaceae

Plant External Links:

NCBI TaxonomyDB: 379956
Plant-of-the-World-Online: 322492-2

Used in Medicines

Unknown.

Geographical Distribution

Turkey; Italy; France; Ireland; Norway; Belarus; Iran; Iceland; Germany; Belgium; Kazakhstan; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Sweden; Greenland; Switzerland; Russia; Bulgaria; Romania; Albania; United Kingdom; Austria; Greece; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

36 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


0 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

24 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC881

Ingredient ID: NPC77672

Ingredient ID: NPC64135

Ingredient ID: NPC58190

Ingredient ID: NPC43123

Ingredient ID: NPC37798

Ingredient ID: NPC37793

Ingredient ID: NPC37668

Ingredient ID: NPC312727

Ingredient ID: NPC302857

Ingredient ID: NPC293344

Ingredient ID: NPC281131

Ingredient ID: NPC280945

Ingredient ID: NPC27973

Ingredient ID: NPC278068

Ingredient ID: NPC268266

Ingredient ID: NPC253662

Ingredient ID: NPC252979

Ingredient ID: NPC247434

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC212628

Ingredient ID: NPC201814

Ingredient ID: NPC194454

Ingredient ID: NPC180474

Ingredient ID: NPC178134

Ingredient ID: NPC172419

Ingredient ID: NPC168579

Ingredient ID: NPC126029

Ingredient ID: NPC114791

Ingredient ID: NPC114242

Ingredient ID: NPC109245

Ingredient ID: NPC108455

Ingredient ID: NPC105799

Ingredient ID: NPC104222

Ingredient ID: NPC102121