• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Halimodendron Halodendron


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ATGCCTTACATGCAGACCGACCTGTGAATTTGTTTGAACACATAGGGTTGGCTTGAGGTGTTCCATGCCTCGACTTCCCTTGATGTAGGAGGGGGCCGCCAGTGCGTCTCCCTGCTGCCTAAACACAAACCCCGGCGCTGAATGTGCCAAGGAACTAAATTTCGTTCAGTGCGCCCCCGTTGGCCCGGAGACGGTGCTCCTGCGGGTGGTGTTTTGAAGCATGACACATAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATCGTTGCCCGATGCCAATTTCCTCTTGATAGGAGGCATGTTGTGCAGGGTGAATGATGGCTTCCCGTGAGCATTGTTGCCTCATGGTTGGTTGAAAATTGAGTCCTTGGTAGGGTGTGCCATGATTGATGGTGGTTGAGTGATGCACGAGACCATATCATGTGAGATTCTACCAAACTTGGCCTCTGTGACCCACGTGCGTCTTTGAACGCTCATGACGAGACCTCACGTCAGGC

Click for details-----ITS1

TCGATGCCTTACATGCAGACCGACCTGTGAATTTGTTTGAACACATAGGGTTGGCTTGAGGTGTTCCATGCCTCGACCTCCCTTGATGTAGGAGGGGGCCACCAGTGCGTCTCCCTGCTCTGCCTAAACACAAACCCCGGCGCTGAATGTGCCAAGGAACTAAATTTTGTTCAGTGCGCCCCCGTTGGCCCGGAGACGGTGCTCCTGCGGGTGGTGTTTTGAAGCATGACACATAA

Click for details-----ITS2

ATCGTTGCCCGATGCCAATTTCCTCTTGATAGGAGGCATGTTGTGCAGGGTGAATGATGGCTTCCCGTGAGCATTGTTGCCTCATGGTTGGTTGAAAATTGAGTCCTTGGTAGGGTGTGCCATGATTGATGGTGGTTGAGTGATGCACGAGACCATATCATGTGAGATTCTACCAAACTTGGCCTCTGTGACCCACGTGCGTCTTTGAACGCTCATGACGAGACCTCACGTCAGGC
Taxonomic Information

Plant ID: NPO4064
Plant Latin Name: Halimodendron Halodendron
Taxonomy Genus: Halimodendron
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 47657
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

136 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


113 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

57 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99968

Ingredient ID: NPC96572

Ingredient ID: NPC95973

Ingredient ID: NPC92032

Ingredient ID: NPC89890

Ingredient ID: NPC89474

Ingredient ID: NPC88756

Ingredient ID: NPC88439

Ingredient ID: NPC82501

Ingredient ID: NPC79419

Ingredient ID: NPC78225

Ingredient ID: NPC75372

Ingredient ID: NPC70460

Ingredient ID: NPC69769

Ingredient ID: NPC68093

Ingredient ID: NPC67650

Ingredient ID: NPC66475

Ingredient ID: NPC64407

Ingredient ID: NPC64061

Ingredient ID: NPC61010

Ingredient ID: NPC52611

Ingredient ID: NPC5052

Ingredient ID: NPC42054

Ingredient ID: NPC40864

Ingredient ID: NPC38739

Ingredient ID: NPC37870

Ingredient ID: NPC36605

Ingredient ID: NPC33051

Ingredient ID: NPC32243

Ingredient ID: NPC31913

Ingredient ID: NPC312823

Ingredient ID: NPC311750

Ingredient ID: NPC306847

Ingredient ID: NPC303742

Ingredient ID: NPC303187

Ingredient ID: NPC301710

Ingredient ID: NPC300727

Ingredient ID: NPC299732

Ingredient ID: NPC298409

Ingredient ID: NPC297323

Ingredient ID: NPC29480

Ingredient ID: NPC294558

Ingredient ID: NPC292859

Ingredient ID: NPC292725

Ingredient ID: NPC290928

Ingredient ID: NPC290467

Ingredient ID: NPC283262

Ingredient ID: NPC280128

Ingredient ID: NPC279242

Ingredient ID: NPC278760

Ingredient ID: NPC275780

Ingredient ID: NPC275090

Ingredient ID: NPC272552

Ingredient ID: NPC270578

Ingredient ID: NPC269443

Ingredient ID: NPC268946

Ingredient ID: NPC266499

Ingredient ID: NPC262307

Ingredient ID: NPC261800

Ingredient ID: NPC261729

Ingredient ID: NPC256364

Ingredient ID: NPC253543

Ingredient ID: NPC25152

Ingredient ID: NPC249394

Ingredient ID: NPC248638

Ingredient ID: NPC246010

Ingredient ID: NPC245511

Ingredient ID: NPC241904

Ingredient ID: NPC24161

Ingredient ID: NPC240537

Ingredient ID: NPC239518

Ingredient ID: NPC236521

Ingredient ID: NPC236202

Ingredient ID: NPC23317

Ingredient ID: NPC230775

Ingredient ID: NPC228785

Ingredient ID: NPC227337

Ingredient ID: NPC226108

Ingredient ID: NPC225613

Ingredient ID: NPC222341

Ingredient ID: NPC22133

Ingredient ID: NPC221202

Ingredient ID: NPC219876

Ingredient ID: NPC214702

Ingredient ID: NPC214360

Ingredient ID: NPC206238

Ingredient ID: NPC205772

Ingredient ID: NPC200704

Ingredient ID: NPC199789

Ingredient ID: NPC198043

Ingredient ID: NPC197206

Ingredient ID: NPC194856

Ingredient ID: NPC192228

Ingredient ID: NPC191146

Ingredient ID: NPC189473

Ingredient ID: NPC188433

Ingredient ID: NPC187097

Ingredient ID: NPC186397

Ingredient ID: NPC18457

Ingredient ID: NPC183307

Ingredient ID: NPC179315

Ingredient ID: NPC179227

Ingredient ID: NPC179065

Ingredient ID: NPC178964

Ingredient ID: NPC176388

Ingredient ID: NPC174097

Ingredient ID: NPC172259

Ingredient ID: NPC170245

Ingredient ID: NPC169479

Ingredient ID: NPC169171

Ingredient ID: NPC168977

Ingredient ID: NPC168247

Ingredient ID: NPC166054

Ingredient ID: NPC165977

Ingredient ID: NPC155259

Ingredient ID: NPC152951

Ingredient ID: NPC152872

Ingredient ID: NPC146134

Ingredient ID: NPC14353

Ingredient ID: NPC142339

Ingredient ID: NPC139501

Ingredient ID: NPC135801

Ingredient ID: NPC133970

Ingredient ID: NPC126029

Ingredient ID: NPC125252

Ingredient ID: NPC124319

Ingredient ID: NPC123437

Ingredient ID: NPC123416

Ingredient ID: NPC119224

Ingredient ID: NPC114056

Ingredient ID: NPC111951

Ingredient ID: NPC111758

Ingredient ID: NPC10926

Ingredient ID: NPC107672

Ingredient ID: NPC105598

Ingredient ID: NPC103318