CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Gentiana Lutea

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGAAGCAGACGACCCGAGGACATGTTTAAAGCACGGGCTTTCGGGACGAGGGAAACCACGGACCGATGCCCCGAGCACGGCGTCGGCCACCGGCCGCTCTCCGTGCAAACAACCAACCCCGGGCGCATAAACGCGCCAAGGAAAACGAAAAAAGGATGGCCTGCCTCCCGTCGCGCCGTACGCGGTGCGTGCTGGAGGATCACGGGCGCCTGAAGAAACGAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCACACCGTGCAYGAAATCATGCCGGTCGTCGGAGGGGCGGATATTGGCTTCCCGTGCTTCGGTGCGGCTGGCCTAAATGGGAGTCCCTTGCGGCGGACACGACGACAAGTGGTGGTTGATTGCCTCGACTAARGTGCTGTCGCGCGCTGCCCCGTCGGATGAGGAGACTTACTTGACCCTGATGCATGCGTCGTCACGACGCCTGCCACGAC

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCCCCCCCACACCGTGCAYGAAATCATGCCGGTCGTCGGAGGGGCGGATATTGGCTTCCCGTGCTTCGGTGCGGCTGGCCTAAATGGGAGTCCCTTGCGGCGGACACGACGACAAGTGGTGGTTGATTGCCTCGACTAARGTGCTGTCGCGCGCTGCCCCGTCGGATGAGGAGACTTACTTGACCCTGATGCATGCGTCGTCACGACGCCTGCCACGAC

Taxonomic Information

Plant ID: NPO403
Plant Latin Name: Gentiana Lutea
Taxonomy Genus: Gentiana
Taxonomy Family: Gentianaceae

Plant External Links:

NCBI TaxonomyDB: 38851
Plant-of-the-World-Online: 368453-1

Used in Medicines

Country/Region:

Romania; Albania; India; Switzerland; Spain; Bulgaria

Traditional Medicine System:

Medicinal Functions:

Anthelmintic; Antiinflammatory; Antiseptic; Appetizer; Bitter; Cholagogue; Emmenagogue; Febrifuge; Refrigerant; Stomachic; Tonic

Geographical Distribution

Turkey; Ukraine; Romania; Albania; Italy; Portugal; India; France; Austria; Germany; Greece; Switzerland; Spain; Bulgaria

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

72 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

46 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)