• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pedicularis Procera


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCAGCAAAATCAGACCGCGAACACGTTAAACCACATTGGGATCGCGGGTCTTTTGGGGAGACCCTTTGACCGCGCCCACCTCTCGCACAGCGTGCGCCTAGGCGCGCGTTGTGCGGGCTAACGAACCCCGGCGCGGCATGCGCCAAGGAAAACTCACAGAAGCGTCTGCCTCCCATCTCCCCGTTCGCGGTGTGGGGTGGGGGGAACTGACGTCTCTCCAATGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCTCGTCGCCTCCCCTACCCATTCCCCACGGGGCGATCGGGTGTAGGGGGCGGAAATTGGCCCCCCGTGCGCTAAGCCGCGCGGCCGGCCTAAATGCGAACCTGTGGCGACTCGCGTCTCGACCGTGGTAGTTGAACACTCAACTCTCGTGCTGTCGTGTCGTTTAGAGTGCGCCGTCAGGCTTCATCGCAGACCCATCGGCGCGATCCTATCGTGCCTTCGACCGCGACCC

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO4024
Plant Latin Name: Pedicularis Procera
Taxonomy Genus: Pedicularis
Taxonomy Family: Orobanchaceae

Plant External Links:

NCBI TaxonomyDB: 70068
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


4 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC84908

Ingredient ID: NPC43094

Ingredient ID: NPC294815

Ingredient ID: NPC225434

Ingredient ID: NPC176740

Ingredient ID: NPC157915

Ingredient ID: NPC154159

Ingredient ID: NPC137780

Ingredient ID: NPC131192

Ingredient ID: NPC120464