• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Chlamydomonas Reinhardtii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AATCTATCACAATCCACACCGCGAACTAACACTGTTGGCCTCCGTCTGTGTAAAAGCAAACGGGCCAGGTCTGGGCGCAATGTAAAAGTTACGCCTGGCCTGGGTTGCCGCAAGGCATCGGTCTCTTATACTAACCAACCAACACCAAACCAAAACTAAATTAAAACCGAGTATCTAGCTTAGAGCTAGTGCTCACTAACCAAGACAACTCTCAACAACGGATATCTTGGCTCTCGGATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAAATACGTGAATCATCGAATCTTTGAACGCATATTGCGCTCGAGGCTTCGGCCAAGAGCATGTCTGCCTCAGCGTCGGGTTAATACTCGCCCTACTCCAACATACACTTGTGTGTTTGGAGCAAGAGCGGACCTGGCTGTCTCGGTGTTTGATTTTCGGATCAGACGCCGGGTCAGCTGAAGTACAGAGGTTGATGCATGGACCCGCTTATGGGCCTCTACTGGGTAGGCAACTCGTTGCTAATGCTTTAGTAGATGGCTTGGAGCTGTGCTTGTCGACCCAAACCAGGAACTTTGGCCCTGTGCCGAAGCAAACCCCTATTTTCTCGACCTGAGCTCAGGCAAGA

Click for details-----ITS1

AATCTATCACAATCCACCACACATGCGAACCATAAGCGTTGGCCCCCTGCTCGAGTAAAATCGAACAGGTGCCAGGGCAGCAGAGCTTCCTCACGGAAACTGCGGCCTTGGGTCGCCTTGGGTGCGCCTCGTGCGTGCCCCGGGCGTTGGTCTTATACTAACCAACCAACACCAAACTATAAATTAAATTAAATCGAGTGTCTGGCCTAGGGCCAGTGCTCACCAACCAAGA

Click for details-----ITS2

TAATACTCGCCCTACTCCAACATACACTTGTGTGTTTGGAGCAAGAGCGGACCTGGCTGTCTCGGTGTTTGATTTTCGGATCAGACGCCGGGTCAGCTGAAGTACAGAGGTTGATGCATGGACCCGCTTATGGGCCTCTACTGGGTAGGCAACTCGTTGCTAATGCTTTAGTAGATGGCTTGGAGCTGTGCTTGTCGACCCAAACCAGGAACTTTGGCCCTGTGCCGAAGCAAACCCCTATTTTCTCGACCTGAGCTCAGGCAAGA
Taxonomic Information

Plant ID: NPO4011
Plant Latin Name: Chlamydomonas Reinhardtii
Taxonomy Genus: Chlamydomonas
Taxonomy Family: Chlamydomonadaceae

Plant External Links:

NCBI TaxonomyDB: 3055
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

166 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


79 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

80 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98098

Ingredient ID: NPC96806

Ingredient ID: NPC94699

Ingredient ID: NPC93081

Ingredient ID: NPC92474

Ingredient ID: NPC85813

Ingredient ID: NPC79788

Ingredient ID: NPC77296

Ingredient ID: NPC7642

Ingredient ID: NPC76217

Ingredient ID: NPC75028

Ingredient ID: NPC72022

Ingredient ID: NPC70204

Ingredient ID: NPC6828

Ingredient ID: NPC66995

Ingredient ID: NPC66667

Ingredient ID: NPC66343

Ingredient ID: NPC64242

Ingredient ID: NPC62765

Ingredient ID: NPC57078

Ingredient ID: NPC55920

Ingredient ID: NPC5505

Ingredient ID: NPC50713

Ingredient ID: NPC48623

Ingredient ID: NPC45428

Ingredient ID: NPC40187

Ingredient ID: NPC38930

Ingredient ID: NPC38891

Ingredient ID: NPC36565

Ingredient ID: NPC36061

Ingredient ID: NPC35661

Ingredient ID: NPC33867

Ingredient ID: NPC329095

Ingredient ID: NPC328832

Ingredient ID: NPC328448

Ingredient ID: NPC328278

Ingredient ID: NPC326808

Ingredient ID: NPC326760

Ingredient ID: NPC326459

Ingredient ID: NPC326391

Ingredient ID: NPC325307

Ingredient ID: NPC323552

Ingredient ID: NPC323401

Ingredient ID: NPC322110

Ingredient ID: NPC319972

Ingredient ID: NPC318935

Ingredient ID: NPC318903

Ingredient ID: NPC318107

Ingredient ID: NPC317825

Ingredient ID: NPC314662

Ingredient ID: NPC31433

Ingredient ID: NPC309330

Ingredient ID: NPC307063

Ingredient ID: NPC30374

Ingredient ID: NPC301950

Ingredient ID: NPC301718

Ingredient ID: NPC301585

Ingredient ID: NPC29883

Ingredient ID: NPC292422

Ingredient ID: NPC291158

Ingredient ID: NPC289758

Ingredient ID: NPC28657

Ingredient ID: NPC281471

Ingredient ID: NPC280582

Ingredient ID: NPC279026

Ingredient ID: NPC272614

Ingredient ID: NPC271585

Ingredient ID: NPC270249

Ingredient ID: NPC26996

Ingredient ID: NPC267753

Ingredient ID: NPC26741

Ingredient ID: NPC261080

Ingredient ID: NPC260833

Ingredient ID: NPC259162

Ingredient ID: NPC258690

Ingredient ID: NPC249288

Ingredient ID: NPC248889

Ingredient ID: NPC248500

Ingredient ID: NPC245027

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC241720

Ingredient ID: NPC241199

Ingredient ID: NPC238532

Ingredient ID: NPC237812

Ingredient ID: NPC236709

Ingredient ID: NPC23155

Ingredient ID: NPC228892

Ingredient ID: NPC226723

Ingredient ID: NPC224999

Ingredient ID: NPC224651

Ingredient ID: NPC224344

Ingredient ID: NPC216630

Ingredient ID: NPC216358

Ingredient ID: NPC216257

Ingredient ID: NPC211895

Ingredient ID: NPC209970

Ingredient ID: NPC208793

Ingredient ID: NPC206264

Ingredient ID: NPC202229

Ingredient ID: NPC201844

Ingredient ID: NPC201578

Ingredient ID: NPC199837

Ingredient ID: NPC197207

Ingredient ID: NPC197087

Ingredient ID: NPC196924

Ingredient ID: NPC19576

Ingredient ID: NPC195232

Ingredient ID: NPC193989

Ingredient ID: NPC192400

Ingredient ID: NPC192074

Ingredient ID: NPC19101

Ingredient ID: NPC186806

Ingredient ID: NPC185991

Ingredient ID: NPC184658

Ingredient ID: NPC182466

Ingredient ID: NPC181516

Ingredient ID: NPC177818

Ingredient ID: NPC17743

Ingredient ID: NPC176017

Ingredient ID: NPC174668

Ingredient ID: NPC174246

Ingredient ID: NPC172282

Ingredient ID: NPC171615

Ingredient ID: NPC165123

Ingredient ID: NPC164957

Ingredient ID: NPC157340

Ingredient ID: NPC156461

Ingredient ID: NPC154738

Ingredient ID: NPC154186

Ingredient ID: NPC153870

Ingredient ID: NPC15378

Ingredient ID: NPC153588

Ingredient ID: NPC151968

Ingredient ID: NPC148965

Ingredient ID: NPC147335

Ingredient ID: NPC143227

Ingredient ID: NPC142330

Ingredient ID: NPC141136

Ingredient ID: NPC140777

Ingredient ID: NPC137958

Ingredient ID: NPC136349

Ingredient ID: NPC133948

Ingredient ID: NPC130683

Ingredient ID: NPC130382

Ingredient ID: NPC128986

Ingredient ID: NPC128225

Ingredient ID: NPC126925

Ingredient ID: NPC126681

Ingredient ID: NPC125892

Ingredient ID: NPC125072

Ingredient ID: NPC121797

Ingredient ID: NPC120649

Ingredient ID: NPC114928

Ingredient ID: NPC114687

Ingredient ID: NPC11433

Ingredient ID: NPC114310

Ingredient ID: NPC113101

Ingredient ID: NPC112890

Ingredient ID: NPC112274

Ingredient ID: NPC111607

Ingredient ID: NPC111138

Ingredient ID: NPC10781

Ingredient ID: NPC106551

Ingredient ID: NPC100684

Ingredient ID: NPC100551