• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aquilegia Ecalcarata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GACCTGCGGAAGGATCATTGTCGAAACCTGCTCAAGCAGAACGACCCGCGAACACGTGAAAACAACCATGTAGGGGTCCGGGGAGGGGCGCGAGCCCCCGACCGATCCCTTCGCCGTTCCGCGGCCCCGACCGCATGCGGTCGTCCGTGGTCCGGCACAAACCAAAAACCCGACGCAATTGGCGTCAAGGAAATCTTAGCGGAAACAAGGCCTAGCCCTGCTTGCGGGGCGAAGTCGCGAATCCGATATTTGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACACAGCGTCGCCCCCAATCCACACTTGTTGTGGTAGGGGAGCGGAGATTGGCCCCCCGAGCCCTCGCGGGCGCGGTCGGCACAAATGCTGGTCCCTGGCAGCGGTCGCCGCGGTCAAGTGGTGGCTTCAAATACCATTTCGGTGACCGGTTGGCTCCGCGGCCATAGTTGGGACCGAATCGACCCGCAGAGGCCGTTCCGACGGCGTTTCACC

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO4004
Plant Latin Name: Aquilegia Ecalcarata
Taxonomy Genus: Aquilegia
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 46965
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

125 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


85 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

67 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95031

Ingredient ID: NPC88566

Ingredient ID: NPC87854

Ingredient ID: NPC84721

Ingredient ID: NPC84030

Ingredient ID: NPC83638

Ingredient ID: NPC81035

Ingredient ID: NPC78500

Ingredient ID: NPC7654

Ingredient ID: NPC76510

Ingredient ID: NPC76315

Ingredient ID: NPC76145

Ingredient ID: NPC71074

Ingredient ID: NPC70432

Ingredient ID: NPC68889

Ingredient ID: NPC68409

Ingredient ID: NPC68098

Ingredient ID: NPC61

Ingredient ID: NPC60339

Ingredient ID: NPC56014

Ingredient ID: NPC54925

Ingredient ID: NPC52021

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC47646

Ingredient ID: NPC46274

Ingredient ID: NPC46248

Ingredient ID: NPC45536

Ingredient ID: NPC45270

Ingredient ID: NPC43211

Ingredient ID: NPC3824

Ingredient ID: NPC36530

Ingredient ID: NPC34679

Ingredient ID: NPC32365

Ingredient ID: NPC312454

Ingredient ID: NPC311517

Ingredient ID: NPC311348

Ingredient ID: NPC306541

Ingredient ID: NPC30621

Ingredient ID: NPC304873

Ingredient ID: NPC304309

Ingredient ID: NPC301610

Ingredient ID: NPC300351

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC292559

Ingredient ID: NPC286212

Ingredient ID: NPC283170

Ingredient ID: NPC280945

Ingredient ID: NPC279121

Ingredient ID: NPC278102

Ingredient ID: NPC275407

Ingredient ID: NPC274179

Ingredient ID: NPC270849

Ingredient ID: NPC270180

Ingredient ID: NPC260727

Ingredient ID: NPC259733

Ingredient ID: NPC257124

Ingredient ID: NPC252997

Ingredient ID: NPC243728

Ingredient ID: NPC241784

Ingredient ID: NPC239117

Ingredient ID: NPC235053

Ingredient ID: NPC232083

Ingredient ID: NPC230301

Ingredient ID: NPC227632

Ingredient ID: NPC226538

Ingredient ID: NPC226374

Ingredient ID: NPC226250

Ingredient ID: NPC216746

Ingredient ID: NPC214691

Ingredient ID: NPC210457

Ingredient ID: NPC210003

Ingredient ID: NPC209431

Ingredient ID: NPC20505

Ingredient ID: NPC204243

Ingredient ID: NPC204120

Ingredient ID: NPC202904

Ingredient ID: NPC201384

Ingredient ID: NPC200209

Ingredient ID: NPC197545

Ingredient ID: NPC195667

Ingredient ID: NPC190810

Ingredient ID: NPC189248

Ingredient ID: NPC189142

Ingredient ID: NPC184105

Ingredient ID: NPC183950

Ingredient ID: NPC18205

Ingredient ID: NPC18074

Ingredient ID: NPC178890

Ingredient ID: NPC176309

Ingredient ID: NPC173696

Ingredient ID: NPC165991

Ingredient ID: NPC165940

Ingredient ID: NPC162742

Ingredient ID: NPC158654

Ingredient ID: NPC158059

Ingredient ID: NPC157193

Ingredient ID: NPC155500

Ingredient ID: NPC152384

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC150610

Ingredient ID: NPC14568

Ingredient ID: NPC142415

Ingredient ID: NPC141777

Ingredient ID: NPC140688

Ingredient ID: NPC137949

Ingredient ID: NPC130209

Ingredient ID: NPC128988

Ingredient ID: NPC128543

Ingredient ID: NPC124774

Ingredient ID: NPC12319

Ingredient ID: NPC120217

Ingredient ID: NPC119949

Ingredient ID: NPC119620

Ingredient ID: NPC119092

Ingredient ID: NPC118726

Ingredient ID: NPC117707

Ingredient ID: NPC116140

Ingredient ID: NPC113733

Ingredient ID: NPC113294

Ingredient ID: NPC11089

Ingredient ID: NPC109813

Ingredient ID: NPC102738