• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Corynanthe Pachyceras


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCTGCCCCTACAAATTGTGTGGGGCGGCGGATGTTGGCCTCCCGTGCCGTCAAGCGCGGCCGGCCTAAATGAGAGTCCTCGGCGAGGACGTCACGACGAGTGGTGGTTGAATGCCCCGACTCGATTTCTGTCGTGCCGGTTCCCCTCGCTGTCTCCGGCTCTACGAATGACCCTCGCGCGCTCTCTATTTGGAGTCGCGCTCCGACC
Taxonomic Information

Plant ID: NPO3965
Plant Latin Name: Corynanthe Pachyceras
Taxonomy Genus: Corynanthe
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 170031
Plant-of-the-World-Online: 747604-1

Used in Medicines

Unknown.

Geographical Distribution

Ghana; Liberia; Equatorial Guinea; Guinea; Sierra Leone; Togo; Congo; Gabon; Nigeria; Cameroon; Cote d'Ivoire; Benin

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

63 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


48 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

48 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC88278

Ingredient ID: NPC76336

Ingredient ID: NPC74646

Ingredient ID: NPC72805

Ingredient ID: NPC58588

Ingredient ID: NPC51633

Ingredient ID: NPC47474

Ingredient ID: NPC39793

Ingredient ID: NPC37733

Ingredient ID: NPC35961

Ingredient ID: NPC34770

Ingredient ID: NPC34700

Ingredient ID: NPC305016

Ingredient ID: NPC29883

Ingredient ID: NPC295492

Ingredient ID: NPC290497

Ingredient ID: NPC277728

Ingredient ID: NPC274613

Ingredient ID: NPC269367

Ingredient ID: NPC266249

Ingredient ID: NPC264145

Ingredient ID: NPC258903

Ingredient ID: NPC253746

Ingredient ID: NPC250476

Ingredient ID: NPC247553

Ingredient ID: NPC243728

Ingredient ID: NPC24101

Ingredient ID: NPC239608

Ingredient ID: NPC235076

Ingredient ID: NPC225710

Ingredient ID: NPC225177

Ingredient ID: NPC220210

Ingredient ID: NPC219913

Ingredient ID: NPC21429

Ingredient ID: NPC213197

Ingredient ID: NPC213087

Ingredient ID: NPC205689

Ingredient ID: NPC205372

Ingredient ID: NPC202399

Ingredient ID: NPC197304

Ingredient ID: NPC195749

Ingredient ID: NPC195334

Ingredient ID: NPC192638

Ingredient ID: NPC186908

Ingredient ID: NPC186098

Ingredient ID: NPC181465

Ingredient ID: NPC179704

Ingredient ID: NPC178134

Ingredient ID: NPC176740

Ingredient ID: NPC159418

Ingredient ID: NPC157931

Ingredient ID: NPC156654

Ingredient ID: NPC156461

Ingredient ID: NPC141862

Ingredient ID: NPC138374

Ingredient ID: NPC131885

Ingredient ID: NPC131192

Ingredient ID: NPC123965

Ingredient ID: NPC12396

Ingredient ID: NPC118121

Ingredient ID: NPC115944

Ingredient ID: NPC108455

Ingredient ID: NPC103409