• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hortonia Floribunda


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTGAACCTGCGGAAGGATCATTGTCGTGAGCTTGAGCCACCGGTGAACTAAGTTCTGTCACTCCAGTTCGTGGGGGCGTGCCTCTGAGGACGGGAGCTCGTCTCGGTCGTCTTCCTTCGCATGTTGAGGGTCGGCTGAGCGACGGCCCTGCCTCGGGGTGTGCGACTGCGCGAGCAGACACCTTTAGGGCGCGACTCGCGCCAAGGGCTTGTAGGGGATTGAGCGGCATCCTGTCTCGGTGGCCCACCTGCCCAATGCGATGGTTGCGGCTTGCCGGTGGGATCGGACCCGCGTCTCTGGCTTTAAAGACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGGACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCACTCGGCTGAGGGCACGTCTGCCTGGGCATCACGTCACCCACAGCTCCCCTGTGCCTGTTCGTTTGGCGGATCGGGAAGCGGAGATTGGCCGTCCGTGCCTGGCTTGGCGTGGTTGGCCCAAAAAGCTGGTCACAGTGCGACACGGCACGACGTGTGTTGGTTGAGTTGCTACTCGTCGGAGCTTTGAGCGTCGCGCCGGTTGTCCCGTAGCACTTGCCCACTCGTGGGGACCCATCTTGCCCGCTTCGGCGGGTGCTCGAA

Click for details-----ITS1

GTGAACCTGCGGAAGGATCATTGTCGTGAGCTTGAGCCACCGGTGAACTAAGTTCTGTCACTCCAGTTCGTGGGGGCGTGCCTCTGAGGACGGGAGCTCGTCTCGGTCGTCTTCCTTCGCATGTTGAGGGTCGGCTGAGCGACGGCCCTGCCTCGGGGTGTGCGACTGCGCGAGCAGACACCTTTAGGGCGCGACTCGCGCCAAGGGCTTGTAGGGGATTGAGCGGCATCCTGTCTCGGTGGCCCACCTGCCCAATGCGATGGTTGCGGCTTGCCGGTGGGATCGGACCCGCGTCTCTGGCTTTAAAGA

Click for details-----ITS2

CACCCACAGCTCCCCTGTGCCTGTTCGTTTGGCGGATCGGGAAGCGGAGATTGGCCGTCCGTGCCTGGCTTGGCGTGGTTGGCCCAAAAAGCTGGTCACAGTGCGACACGGCACGACGTGTGTTGGTTGAGTTGCTACTCGTCGGAGCTTTGAGCGTCGCGCCGGTTGTCCCGTAGCACTTGCCCACTCGTGGGGACCCATCTTGCCCGCTTCGGCGGGTGCTCGAA
Taxonomic Information

Plant ID: NPO3963
Plant Latin Name: Hortonia Floribunda
Taxonomy Genus: Hortonia
Taxonomy Family: Monimiaceae

Plant External Links:

NCBI TaxonomyDB: 74875
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

137 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


108 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

53 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9874

Ingredient ID: NPC93433

Ingredient ID: NPC92615

Ingredient ID: NPC91871

Ingredient ID: NPC90982

Ingredient ID: NPC90757

Ingredient ID: NPC88806

Ingredient ID: NPC87725

Ingredient ID: NPC87213

Ingredient ID: NPC86438

Ingredient ID: NPC86249

Ingredient ID: NPC85726

Ingredient ID: NPC81803

Ingredient ID: NPC81010

Ingredient ID: NPC81002

Ingredient ID: NPC80600

Ingredient ID: NPC80103

Ingredient ID: NPC78445

Ingredient ID: NPC76356

Ingredient ID: NPC76336

Ingredient ID: NPC74351

Ingredient ID: NPC74331

Ingredient ID: NPC73369

Ingredient ID: NPC71778

Ingredient ID: NPC70744

Ingredient ID: NPC6984

Ingredient ID: NPC63973

Ingredient ID: NPC61461

Ingredient ID: NPC5586

Ingredient ID: NPC53639

Ingredient ID: NPC52086

Ingredient ID: NPC51717

Ingredient ID: NPC51570

Ingredient ID: NPC49555

Ingredient ID: NPC47094

Ingredient ID: NPC37947

Ingredient ID: NPC37468

Ingredient ID: NPC35700

Ingredient ID: NPC35300

Ingredient ID: NPC34770

Ingredient ID: NPC34103

Ingredient ID: NPC32163

Ingredient ID: NPC311986

Ingredient ID: NPC309557

Ingredient ID: NPC306244

Ingredient ID: NPC303409

Ingredient ID: NPC301377

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC296427

Ingredient ID: NPC294470

Ingredient ID: NPC291454

Ingredient ID: NPC290598

Ingredient ID: NPC28983

Ingredient ID: NPC288943

Ingredient ID: NPC287992

Ingredient ID: NPC287301

Ingredient ID: NPC284323

Ingredient ID: NPC280077

Ingredient ID: NPC279921

Ingredient ID: NPC276808

Ingredient ID: NPC276268

Ingredient ID: NPC273070

Ingredient ID: NPC272695

Ingredient ID: NPC272537

Ingredient ID: NPC272415

Ingredient ID: NPC271985

Ingredient ID: NPC269367

Ingredient ID: NPC265007

Ingredient ID: NPC263417

Ingredient ID: NPC263367

Ingredient ID: NPC262725

Ingredient ID: NPC258546

Ingredient ID: NPC25772

Ingredient ID: NPC251102

Ingredient ID: NPC250476

Ingredient ID: NPC248355

Ingredient ID: NPC245561

Ingredient ID: NPC24402

Ingredient ID: NPC241465

Ingredient ID: NPC241105

Ingredient ID: NPC241055

Ingredient ID: NPC241025

Ingredient ID: NPC240722

Ingredient ID: NPC235431

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC227698

Ingredient ID: NPC227678

Ingredient ID: NPC227302

Ingredient ID: NPC226618

Ingredient ID: NPC225665

Ingredient ID: NPC224673

Ingredient ID: NPC219913

Ingredient ID: NPC214702

Ingredient ID: NPC212770

Ingredient ID: NPC20610

Ingredient ID: NPC205796

Ingredient ID: NPC205689

Ingredient ID: NPC205372

Ingredient ID: NPC205054

Ingredient ID: NPC203719

Ingredient ID: NPC202472

Ingredient ID: NPC199194

Ingredient ID: NPC194416

Ingredient ID: NPC192612

Ingredient ID: NPC186418

Ingredient ID: NPC186237

Ingredient ID: NPC182432

Ingredient ID: NPC176015

Ingredient ID: NPC171721

Ingredient ID: NPC170807

Ingredient ID: NPC167539

Ingredient ID: NPC160345

Ingredient ID: NPC160100

Ingredient ID: NPC156654

Ingredient ID: NPC156502

Ingredient ID: NPC155930

Ingredient ID: NPC150919

Ingredient ID: NPC147583

Ingredient ID: NPC145879

Ingredient ID: NPC145054

Ingredient ID: NPC141799

Ingredient ID: NPC140201

Ingredient ID: NPC13789

Ingredient ID: NPC131885

Ingredient ID: NPC130833

Ingredient ID: NPC130754

Ingredient ID: NPC127816

Ingredient ID: NPC12210

Ingredient ID: NPC111888

Ingredient ID: NPC111625

Ingredient ID: NPC110899

Ingredient ID: NPC109418

Ingredient ID: NPC10789

Ingredient ID: NPC102516

Ingredient ID: NPC100079