• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Malva Sylvestris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTGTTCGTACGAATTCCACCGTCTCGGTGAAGTGTTCGGATCGCGATCGCCCGTGGAACTGTTTCTGCTGCCTCCGCGATCGTCGCTAGAAGTACCATTGAACCGTAGCCTCTAGCAGAACGAGAAGTCGTAACAAAGGCTTTCGTAGGGGAACCCCCGGAAGGGTCATTGTCGAAACCTATCCTAGCAGAACGACCCGCGAACGTGTTATCGAACAAACGATCGAGGGGGTGCGGATGCATCCCTGCCCCGAGCCCCCTCGATGCCTCGGCGCGCCGAGCCTTGCCGCATCCGTCCTCGGGCGGGTGTCCCGGGTTTCGTCGCGATCCGAGGCAAAACGAACAACCCCCGGCGCGAATCGCGTCAAGGAATAAAAAATGAAAAGAGTGCGTGTTTCGTTGTCGTATGGCAGCGAGGGCGTTACTCTCGTCGTGAAAATTAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCCCGTCAAACCCCGAGCCCTCGGGCCGGGATCGACGCGCGGGCGGAAATTGGCCTCCCGTGCGCTCACCGCTCGCGGTTGGTCTAAATTCGAGTCCTCGGCGATGATGCGCCGCGACGATCGGTGGGAACGCCTTTGGCTGCCTCGTTCGGAGTCGCGCGCGCTCGTCGATCGGGACGCTTTCGACCCTTTAAGGCATCGCGACGTCGATGCTCGCATCGCGTCCCCAGGTCAGGCGGGATCTCCTTGCAGATTCAAAGCACCCGGAAGAGTGCATTAGAATCCATCGACCATTACGA

Click for details-----ITS1

CGTAGGTGACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGTGTTATCGAACAACCGATCGAGGGGGTGCGGATGCATCCYTGCCCCGAGCCCCCTCGATGCCTCGGCGCGCCGAGCCTTGCCGCATCCGTCCTCGGGCGGGTGTCCCGGGTTTCGTCGCGMTCCGAGGCAAAACGAACAACCCCCGGCGCGAATCGCGTCAAGGAATAAAAAATGAAAAGAGTGCGTGTTTCGTTGTCGTATGGCAGCGAGGGCGTTACTCTCGTCGTGAAAATTAAAAA

Click for details-----ITS2

ATCGTCGCCCCCGTCAAACCCCGAGCCCTCGGGCCGGGATCGACGCGCGGGCGGAAATTGGCCTCCCGTGCGCTCACCGCTCGCGGTTGGTCTAAATTCGAGTCCTCGGCGATGATGCGCCGCGACGATCGGTGGGAACGCCTTTGGCTGCCTCGTTCGGAGTCGCGCGCGCTAGTCGATCGGGACGCTATCGTCCCTTTAAGACATCGCGCCGTCGAGGCTCCCTCGAAATCCCAGGGCACCGGGGAATCCAGAACGGCGAGGACCCGGGGAATCAGAACGGCGAGCACCCGATAGATAATCCCGCC
Taxonomic Information

Plant ID: NPO3936
Plant Latin Name: Malva Sylvestris
Taxonomy Genus: Malva
Taxonomy Family: Malvaceae

Plant External Links:

NCBI TaxonomyDB: 145754
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Italy; Portugal; India; Lebanon; Jordan; China; Spain; Bulgaria

Traditional Medicine System:
Indian Folk; TCM; Unani


Medicinal Functions:

Antiphlogistic; Astringent; Demulcent; Diuretic; Emollient; Expectorant; Laxative; Salve

Geographical Distribution

Turkey; Italy; Portugal; India; Lebanon; Jordan; China; Spain; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

147 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


47 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

47 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99080

Ingredient ID: NPC96300

Ingredient ID: NPC96294

Ingredient ID: NPC95594

Ingredient ID: NPC93105

Ingredient ID: NPC91601

Ingredient ID: NPC90399

Ingredient ID: NPC89870

Ingredient ID: NPC85051

Ingredient ID: NPC81423

Ingredient ID: NPC80902

Ingredient ID: NPC7979

Ingredient ID: NPC75621

Ingredient ID: NPC75011

Ingredient ID: NPC74221

Ingredient ID: NPC73624

Ingredient ID: NPC73216

Ingredient ID: NPC69576

Ingredient ID: NPC67332

Ingredient ID: NPC67125

Ingredient ID: NPC63684

Ingredient ID: NPC63048

Ingredient ID: NPC60635

Ingredient ID: NPC5883

Ingredient ID: NPC57456

Ingredient ID: NPC56932

Ingredient ID: NPC52005

Ingredient ID: NPC51700

Ingredient ID: NPC49254

Ingredient ID: NPC44899

Ingredient ID: NPC43116

Ingredient ID: NPC40394

Ingredient ID: NPC3946

Ingredient ID: NPC36933

Ingredient ID: NPC36337

Ingredient ID: NPC33233

Ingredient ID: NPC31354

Ingredient ID: NPC31171

Ingredient ID: NPC311248

Ingredient ID: NPC308429

Ingredient ID: NPC304542

Ingredient ID: NPC304481

Ingredient ID: NPC304260

Ingredient ID: NPC301263

Ingredient ID: NPC29639

Ingredient ID: NPC295110

Ingredient ID: NPC291379

Ingredient ID: NPC290693

Ingredient ID: NPC290481

Ingredient ID: NPC289501

Ingredient ID: NPC288816

Ingredient ID: NPC284764

Ingredient ID: NPC284536

Ingredient ID: NPC282252

Ingredient ID: NPC281131

Ingredient ID: NPC278990

Ingredient ID: NPC277673

Ingredient ID: NPC27765

Ingredient ID: NPC277336

Ingredient ID: NPC274330

Ingredient ID: NPC273920

Ingredient ID: NPC270426

Ingredient ID: NPC26938

Ingredient ID: NPC268326

Ingredient ID: NPC26500

Ingredient ID: NPC264317

Ingredient ID: NPC260145

Ingredient ID: NPC259960

Ingredient ID: NPC251428

Ingredient ID: NPC2509

Ingredient ID: NPC248729

Ingredient ID: NPC247434

Ingredient ID: NPC247365

Ingredient ID: NPC23858

Ingredient ID: NPC235842

Ingredient ID: NPC23518

Ingredient ID: NPC235023

Ingredient ID: NPC234239

Ingredient ID: NPC232078

Ingredient ID: NPC231518

Ingredient ID: NPC227900

Ingredient ID: NPC226426

Ingredient ID: NPC225163

Ingredient ID: NPC223865

Ingredient ID: NPC223360

Ingredient ID: NPC222236

Ingredient ID: NPC220735

Ingredient ID: NPC220217

Ingredient ID: NPC219998

Ingredient ID: NPC216236

Ingredient ID: NPC215

Ingredient ID: NPC210640

Ingredient ID: NPC209357

Ingredient ID: NPC207689

Ingredient ID: NPC205258

Ingredient ID: NPC20505

Ingredient ID: NPC203050

Ingredient ID: NPC20281

Ingredient ID: NPC199772

Ingredient ID: NPC199428

Ingredient ID: NPC198664

Ingredient ID: NPC194638

Ingredient ID: NPC19114

Ingredient ID: NPC190986

Ingredient ID: NPC190244

Ingredient ID: NPC190120

Ingredient ID: NPC185529

Ingredient ID: NPC181465

Ingredient ID: NPC179986

Ingredient ID: NPC178383

Ingredient ID: NPC176740

Ingredient ID: NPC174098

Ingredient ID: NPC174052

Ingredient ID: NPC173816

Ingredient ID: NPC170456

Ingredient ID: NPC164336

Ingredient ID: NPC163982

Ingredient ID: NPC163771

Ingredient ID: NPC159543

Ingredient ID: NPC156348

Ingredient ID: NPC154374

Ingredient ID: NPC153085

Ingredient ID: NPC152615

Ingredient ID: NPC15257

Ingredient ID: NPC150777

Ingredient ID: NPC148291

Ingredient ID: NPC147905

Ingredient ID: NPC146172

Ingredient ID: NPC142415

Ingredient ID: NPC139929

Ingredient ID: NPC139413

Ingredient ID: NPC136548

Ingredient ID: NPC136133

Ingredient ID: NPC134826

Ingredient ID: NPC129913

Ingredient ID: NPC127549

Ingredient ID: NPC123710

Ingredient ID: NPC120098

Ingredient ID: NPC119855

Ingredient ID: NPC115349

Ingredient ID: NPC113733

Ingredient ID: NPC110041

Ingredient ID: NPC109954

Ingredient ID: NPC105730

Ingredient ID: NPC103534

Ingredient ID: NPC102063

Ingredient ID: NPC101839