• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Dendrobium Nobile


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TAGGTGAACCTGCGGAAGGATCATTGTCGAGACTGAAACACAATGAGCGATTTTGTGAACCTGTAAAAATAAGCGGTGCCTGTAGTGCTGCGATAAAATCCACTCGAGTCATCGCCTCATCCCCTCTTTGGGTTGGGGACGTGATGAAGGATGGATGAACCCTCAAATCGGCGCAGCGTAGCGCCAAGGGAATCTTGAAACACAACCCCATAAATGGGTTTTGTGGGATGGGGTGCTGTCGCACCCCATATTGATTGACACGACTCTCGGCAATGGATATCTCGGCTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATATGTGGTGCGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCAATCGGTTGAGGGCACGTCCGCCTGGGCGTCAAGCGATATGTCGCTCTGTGCTAAGTTAACCATCGATGGATGGGTTGGCGAAGGCTCGGATGTGCATAATGGCTCGTTGTGCCCCTCAGCGTGGCGGGCTGAAGAGGGGGTCATCATCTTGTTAGTCGCAAACAATAAGGGGTGGATAAATATGAGGCCTATGTTATTGTGTTGTGCATGCCCAAGAGATGATTAAACCTTTTTTGTGATCCTAAATCATGCGTCAATCCATGTATGGCGTTTTGA

Click for details-----ITS1

GGGGGCAGCCGGGGAATTGTCGAGACGAACACAATGAGCGATTTTGTGAACCTGTAAAAATAAGCGGTGCCTGTAGTGCTGCGATAAAATCCACTCGAGTCATCGCCTCATCCCCTCTTTGGGGTGGGGACGTGATGAAGGATGGATGAACCCTCAAATCGGCGCAGCGTAGCGCCAAGGGAATCTTGAAACACAAGCCCATAAATGGGTTTTGTGGGATGGGGTGCTGTCGCACGCCATATTGATTGACA

Click for details-----ITS2

ATTTTATCGCTCCGTGCCTAGTCTCCCATCCATGGATGTGTTGCCTAGGCTCGGATGTGCACGGTGGCTCGTCGTGGGCCTTGGTGCGGCGGGCTGAAGGGCGGGTCATCTTCTCGTTGGCTGCCAACAATAAGGGGTGGATTAAATAAGGCCTATGCTATTGTGTCAAGCGCGCCTGAGAGATGGTCATACTTATTAGGTGATCCCAATTCATGCGTCGATCCATGGATGGCGTATCGAATGTGACCGGAGGATGGGCGAGGCCA
Taxonomic Information

Plant ID: NPO3894
Plant Latin Name: Dendrobium Nobile
Taxonomy Genus: Dendrobium
Taxonomy Family: Orchidaceae

Plant External Links:

NCBI TaxonomyDB: 94219
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

175 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


129 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

94 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99816

Ingredient ID: NPC96390

Ingredient ID: NPC80471

Ingredient ID: NPC80370

Ingredient ID: NPC79943

Ingredient ID: NPC77289

Ingredient ID: NPC74576

Ingredient ID: NPC7163

Ingredient ID: NPC69029

Ingredient ID: NPC67813

Ingredient ID: NPC66027

Ingredient ID: NPC65985

Ingredient ID: NPC61198

Ingredient ID: NPC60762

Ingredient ID: NPC57490

Ingredient ID: NPC53781

Ingredient ID: NPC52220

Ingredient ID: NPC50866

Ingredient ID: NPC50146

Ingredient ID: NPC481842

Ingredient ID: NPC4817

Ingredient ID: NPC479230

Ingredient ID: NPC479229

Ingredient ID: NPC479228

Ingredient ID: NPC479227

Ingredient ID: NPC479226

Ingredient ID: NPC479225

Ingredient ID: NPC479224

Ingredient ID: NPC479223

Ingredient ID: NPC479222

Ingredient ID: NPC476969

Ingredient ID: NPC476968

Ingredient ID: NPC461753

Ingredient ID: NPC44816

Ingredient ID: NPC43246

Ingredient ID: NPC42253

Ingredient ID: NPC38017

Ingredient ID: NPC35731

Ingredient ID: NPC34103

Ingredient ID: NPC33998

Ingredient ID: NPC32441

Ingredient ID: NPC321503

Ingredient ID: NPC313000

Ingredient ID: NPC312929

Ingredient ID: NPC311485

Ingredient ID: NPC30506

Ingredient ID: NPC303560

Ingredient ID: NPC298757

Ingredient ID: NPC298346

Ingredient ID: NPC29826

Ingredient ID: NPC297948

Ingredient ID: NPC294884

Ingredient ID: NPC294436

Ingredient ID: NPC292828

Ingredient ID: NPC292394

Ingredient ID: NPC292237

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289185

Ingredient ID: NPC288089

Ingredient ID: NPC285812

Ingredient ID: NPC285776

Ingredient ID: NPC284607

Ingredient ID: NPC284296

Ingredient ID: NPC284265

Ingredient ID: NPC282496

Ingredient ID: NPC282302

Ingredient ID: NPC280766

Ingredient ID: NPC278955

Ingredient ID: NPC277772

Ingredient ID: NPC276737

Ingredient ID: NPC275061

Ingredient ID: NPC275003

Ingredient ID: NPC273109

Ingredient ID: NPC266453

Ingredient ID: NPC266006

Ingredient ID: NPC265151

Ingredient ID: NPC264022

Ingredient ID: NPC262701

Ingredient ID: NPC262297

Ingredient ID: NPC26229

Ingredient ID: NPC258360

Ingredient ID: NPC255643

Ingredient ID: NPC254625

Ingredient ID: NPC254122

Ingredient ID: NPC251855

Ingredient ID: NPC245898

Ingredient ID: NPC245358

Ingredient ID: NPC243996

Ingredient ID: NPC243759

Ingredient ID: NPC243728

Ingredient ID: NPC240722

Ingredient ID: NPC239996

Ingredient ID: NPC230919

Ingredient ID: NPC230301

Ingredient ID: NPC228503

Ingredient ID: NPC227376

Ingredient ID: NPC22610

Ingredient ID: NPC225781

Ingredient ID: NPC221077

Ingredient ID: NPC218604

Ingredient ID: NPC218131

Ingredient ID: NPC217786

Ingredient ID: NPC216630

Ingredient ID: NPC216624

Ingredient ID: NPC213935

Ingredient ID: NPC212832

Ingredient ID: NPC212048

Ingredient ID: NPC209785

Ingredient ID: NPC200696

Ingredient ID: NPC200557

Ingredient ID: NPC197908

Ingredient ID: NPC197757

Ingredient ID: NPC197754

Ingredient ID: NPC196924

Ingredient ID: NPC193544

Ingredient ID: NPC191705

Ingredient ID: NPC18714

Ingredient ID: NPC186268

Ingredient ID: NPC185907

Ingredient ID: NPC175838

Ingredient ID: NPC174885

Ingredient ID: NPC171886

Ingredient ID: NPC171351

Ingredient ID: NPC171261

Ingredient ID: NPC170485

Ingredient ID: NPC170399

Ingredient ID: NPC169782

Ingredient ID: NPC169439

Ingredient ID: NPC16728

Ingredient ID: NPC165159

Ingredient ID: NPC164749

Ingredient ID: NPC161576

Ingredient ID: NPC161037

Ingredient ID: NPC160697

Ingredient ID: NPC158142

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC156461

Ingredient ID: NPC154275

Ingredient ID: NPC153572

Ingredient ID: NPC151752

Ingredient ID: NPC151656

Ingredient ID: NPC151242

Ingredient ID: NPC149337

Ingredient ID: NPC149290

Ingredient ID: NPC143659

Ingredient ID: NPC143159

Ingredient ID: NPC142588

Ingredient ID: NPC142047

Ingredient ID: NPC141765

Ingredient ID: NPC141631

Ingredient ID: NPC141612

Ingredient ID: NPC138248

Ingredient ID: NPC130683

Ingredient ID: NPC130449

Ingredient ID: NPC127582

Ingredient ID: NPC119969

Ingredient ID: NPC117214

Ingredient ID: NPC116907

Ingredient ID: NPC115835

Ingredient ID: NPC112778

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC110373

Ingredient ID: NPC109192

Ingredient ID: NPC108936

Ingredient ID: NPC108198

Ingredient ID: NPC107482

Ingredient ID: NPC105847

Ingredient ID: NPC105718

Ingredient ID: NPC10426

Ingredient ID: NPC103752

Ingredient ID: NPC103180

Ingredient ID: NPC10314