• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ruta Graveolens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CGAAACCTCCCTAGCAGAACGACCCGTGAACAAGTGAATTCACCAGCGGAGGGGGGCAAGCCTCCCCCTGCCTCGGCTCCGAGAGGGCGCTGGATCCGTCTTGCGCCCCTTCGGGGCCCTAACGAACCCCCGGCGCGGAATGCGCCAAGGAAATCTAACGAGAGAGCGAGCTCCGCGGGTTCGCCCGTCGGATGCGTTGCCTTCTTTCACTTATCCAATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCTCCCACCCCTCCCCCTTCGGGGGGCGCGGTCTGTGTGGGGGCGGACAATGGCCTCCCGTGGATTCTCTGTTTGCGGCTGGCCCAAATTTGAGTCTCTGGCTGCGCGAGCCGCGACAATCGGTGGTGAAAACAAAGCCTCTCGAGCTCCTGTCGCGTGCCTGTGCTGGCCCCTGCGAGGACTCAGGACCCATGCGTCGTAGTTACGGCGCTCGCTTCGCGACCCCCG

Click for details-----ITS1

TCGAAAACTTCCTAGCAGAACGACCCGCGAACAAGTTAATTCACTGGCGGAGGGGGGGGGGAAGCCTCCCCCCCCCCCCGGCTCCAGGAGGGCGCGGGATACGTCTTGTGTCCCCTCCTGAGCCCTAACGAACCCCCGGCGCGGAATGCGCCAAGGAAAACCAACGAGAGAGCGAGCTCTGCGGGTTCGCCCGTCGGATGCGCCGCCTTCTTTCACTTATCCAATA

Click for details-----ITS2

ATCATTGCCCCCACCCCTCCCCCTTCGGGGGGTGCGGACTGTGGGGGCGGACAATGGCCTCCCGTTGGCTCTCTGCCTGCGGCTGGTTGAAATATGAGTCTCCGGCTGCACGAGCCGCGACAATCGGTGGTGAAAACAAAGCCTCTCGAGTTCCTGTCGCGTGCATGCGCTGCCCTGCGAGGGCTCATGACCCATGCGTTGTATTTTTGGCGCTCGCT
Taxonomic Information

Plant ID: NPO3854
Plant Latin Name: Ruta Graveolens
Taxonomy Genus: Ruta
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 37565
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Brazil; Madagascar; Italy; Swaziland; Portugal; South Africa; Philippines; Finland; India; Zimbabwe; Algeria; Chile; Greece; Angola; Argentina; China; Spain; Bulgaria

Traditional Medicine System:
Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Abortifacient; Anthelmintic; Antidiarrhoeal; Antidote; Antiinflammatory; Antispasmodic; Carminative; Emetic; Emmenagogue; Expectorant; Haemostatic; Homeopathy; Ophthalmic; Rubefacient; Stimulant; Stomachic

Geographical Distribution

Brazil; Turkey; Madagascar; Angola; Portugal; Algeria; South Africa; Philippines; Finland; India; Swaziland; Zimbabwe; China; Chile; Greece; Italy; Argentina; Spain; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

119 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


108 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

50 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97541

Ingredient ID: NPC96699

Ingredient ID: NPC91620

Ingredient ID: NPC88846

Ingredient ID: NPC88445

Ingredient ID: NPC85613

Ingredient ID: NPC81016

Ingredient ID: NPC76006

Ingredient ID: NPC75881

Ingredient ID: NPC74539

Ingredient ID: NPC72627

Ingredient ID: NPC62943

Ingredient ID: NPC60720

Ingredient ID: NPC60503

Ingredient ID: NPC54416

Ingredient ID: NPC5167

Ingredient ID: NPC51146

Ingredient ID: NPC488346

Ingredient ID: NPC488345

Ingredient ID: NPC488344

Ingredient ID: NPC488343

Ingredient ID: NPC488342

Ingredient ID: NPC488341

Ingredient ID: NPC488340

Ingredient ID: NPC488339

Ingredient ID: NPC488338

Ingredient ID: NPC488337

Ingredient ID: NPC488336

Ingredient ID: NPC488335

Ingredient ID: NPC488334

Ingredient ID: NPC488333

Ingredient ID: NPC488332

Ingredient ID: NPC488331

Ingredient ID: NPC488330

Ingredient ID: NPC488329

Ingredient ID: NPC488328

Ingredient ID: NPC488327

Ingredient ID: NPC488326

Ingredient ID: NPC488325

Ingredient ID: NPC488324

Ingredient ID: NPC41499

Ingredient ID: NPC41400

Ingredient ID: NPC34770

Ingredient ID: NPC34485

Ingredient ID: NPC33320

Ingredient ID: NPC326489

Ingredient ID: NPC326093

Ingredient ID: NPC324424

Ingredient ID: NPC322498

Ingredient ID: NPC321965

Ingredient ID: NPC321166

Ingredient ID: NPC320858

Ingredient ID: NPC319343

Ingredient ID: NPC318459

Ingredient ID: NPC312146

Ingredient ID: NPC307412

Ingredient ID: NPC305648

Ingredient ID: NPC305208

Ingredient ID: NPC300299

Ingredient ID: NPC296663

Ingredient ID: NPC292370

Ingredient ID: NPC288089

Ingredient ID: NPC283810

Ingredient ID: NPC283331

Ingredient ID: NPC281931

Ingredient ID: NPC276761

Ingredient ID: NPC276207

Ingredient ID: NPC274909

Ingredient ID: NPC267801

Ingredient ID: NPC266743

Ingredient ID: NPC265547

Ingredient ID: NPC258750

Ingredient ID: NPC257188

Ingredient ID: NPC254876

Ingredient ID: NPC252256

Ingredient ID: NPC252223

Ingredient ID: NPC247553

Ingredient ID: NPC243062

Ingredient ID: NPC242517

Ingredient ID: NPC237186

Ingredient ID: NPC235682

Ingredient ID: NPC234536

Ingredient ID: NPC230199

Ingredient ID: NPC220241

Ingredient ID: NPC219564

Ingredient ID: NPC219104

Ingredient ID: NPC218109

Ingredient ID: NPC217903

Ingredient ID: NPC217829

Ingredient ID: NPC217176

Ingredient ID: NPC214309

Ingredient ID: NPC209959

Ingredient ID: NPC20082

Ingredient ID: NPC198816

Ingredient ID: NPC198160

Ingredient ID: NPC194502

Ingredient ID: NPC187058

Ingredient ID: NPC185541

Ingredient ID: NPC179605

Ingredient ID: NPC179037

Ingredient ID: NPC172784

Ingredient ID: NPC169

Ingredient ID: NPC168517

Ingredient ID: NPC16066

Ingredient ID: NPC158306

Ingredient ID: NPC153500

Ingredient ID: NPC147661

Ingredient ID: NPC144288

Ingredient ID: NPC141080

Ingredient ID: NPC141068

Ingredient ID: NPC139323

Ingredient ID: NPC131885

Ingredient ID: NPC131296

Ingredient ID: NPC12766

Ingredient ID: NPC116178

Ingredient ID: NPC110008

Ingredient ID: NPC109515

Ingredient ID: NPC103281

Ingredient ID: NPC102285