• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ardisia Japonica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGTGAACTTGTCTTTACTACCGGGACGCATCGGATGGGTCCTTGACCCTCCGGTGTCATCCCCACTAGTGGGTGAGCTCGTTGTCCGTATCGGTTGCGAGTTCACTTCCCTAGTCGAACAACGAACCCCGGCGCAAACCGCGCCAAGGAAATTTAACAAAGAGATCGCGCCCCTTACTCCTGTGCGCGGGTTGTGAGGGGTGATGGAATCTTGTATATAACAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCCCACAATGCGTCGCTCCCCCACGCACCCTCGGGTATCGTGTGAGGTGCGGATACTGGCTCCCCGTGTGCTATCGCACGCGGTCAGCCTAAAAGTGAATCCCGGCGATTGGTGTCGCGGCAAGTGGTGGTTTCCAAACCGTTGCATGTTGTCGTGCGCGCTTCGATCGCCCTCGGTGACTCTTTGACCCTGAAGCTCCATTAGAATGGTGCCACGATCGAGACCCCA

Click for details-----ITS1

TAGTCGAACCTGCACAGCAGAACGACCCGTGAACTTGTCTTTACTACCGGGACGCATCGGATGGGTCCTTGACCCTCCGGTGTCATCCCCACTAGTGGGTGAGCTCGTTGTCCGTATCGGTTGCGAGTTCACTTCCCTAGTCGAACAACGAACCCCGGCGCAAACCGCGCCAAGGAAATTTAACAAAGAGATCGCGCCCCTTACTCCTGTGCGCGGGTTGTGAGGGGTGATGGAATCTTGTATATAACAAAA

Click for details-----ITS2

AATGCGTCGCTCCCCCACGCACCCTCGGGTATCGTGTGAGGTGCGGATACTGGCTCCCCGTGTGCTATCGCACGCGGTCAGCCTAAAAGTGAATCCCGGCGATTGGTGTCGCGGCAAGTGGTGGTTTCCAAACCGTTGCATGTTGTCGTGCGCGCTTCGATCGCCCTCGGTGACTCTTTGACCCTGAAGCTCCATTAGAATGGTGCCACGATCGAGACCCCA
Taxonomic Information

Plant ID: NPO3803
Plant Latin Name: Ardisia Japonica
Taxonomy Genus: Ardisia
Taxonomy Family: Primulaceae

Plant External Links:

NCBI TaxonomyDB: 276775
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antidote; Antitussive; Cancer; Carminative; Depurative; Diuretic; Expectorant

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

121 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


52 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

69 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9794

Ingredient ID: NPC93864

Ingredient ID: NPC93641

Ingredient ID: NPC91947

Ingredient ID: NPC90247

Ingredient ID: NPC88803

Ingredient ID: NPC87633

Ingredient ID: NPC87393

Ingredient ID: NPC84811

Ingredient ID: NPC78324

Ingredient ID: NPC78034

Ingredient ID: NPC73921

Ingredient ID: NPC7343

Ingredient ID: NPC70869

Ingredient ID: NPC69816

Ingredient ID: NPC68795

Ingredient ID: NPC6530

Ingredient ID: NPC64361

Ingredient ID: NPC62082

Ingredient ID: NPC60583

Ingredient ID: NPC52464

Ingredient ID: NPC48957

Ingredient ID: NPC47486

Ingredient ID: NPC470623

Ingredient ID: NPC470622

Ingredient ID: NPC43872

Ingredient ID: NPC41331

Ingredient ID: NPC40716

Ingredient ID: NPC39154

Ingredient ID: NPC39045

Ingredient ID: NPC385

Ingredient ID: NPC3642

Ingredient ID: NPC329188

Ingredient ID: NPC328940

Ingredient ID: NPC325558

Ingredient ID: NPC323231

Ingredient ID: NPC322523

Ingredient ID: NPC320421

Ingredient ID: NPC320283

Ingredient ID: NPC318785

Ingredient ID: NPC318533

Ingredient ID: NPC308240

Ingredient ID: NPC306505

Ingredient ID: NPC306420

Ingredient ID: NPC302857

Ingredient ID: NPC299744

Ingredient ID: NPC298722

Ingredient ID: NPC296841

Ingredient ID: NPC295263

Ingredient ID: NPC292370

Ingredient ID: NPC291449

Ingredient ID: NPC278969

Ingredient ID: NPC276863

Ingredient ID: NPC276324

Ingredient ID: NPC273842

Ingredient ID: NPC273789

Ingredient ID: NPC273023

Ingredient ID: NPC267238

Ingredient ID: NPC266020

Ingredient ID: NPC262567

Ingredient ID: NPC253678

Ingredient ID: NPC253611

Ingredient ID: NPC246974

Ingredient ID: NPC243083

Ingredient ID: NPC24216

Ingredient ID: NPC236675

Ingredient ID: NPC235751

Ingredient ID: NPC232523

Ingredient ID: NPC231051

Ingredient ID: NPC230301

Ingredient ID: NPC229475

Ingredient ID: NPC22709

Ingredient ID: NPC225710

Ingredient ID: NPC224003

Ingredient ID: NPC217954

Ingredient ID: NPC208011

Ingredient ID: NPC20791

Ingredient ID: NPC207693

Ingredient ID: NPC205129

Ingredient ID: NPC199845

Ingredient ID: NPC195986

Ingredient ID: NPC195227

Ingredient ID: NPC193699

Ingredient ID: NPC193673

Ingredient ID: NPC191837

Ingredient ID: NPC191768

Ingredient ID: NPC189575

Ingredient ID: NPC18724

Ingredient ID: NPC186858

Ingredient ID: NPC184457

Ingredient ID: NPC176740

Ingredient ID: NPC173638

Ingredient ID: NPC173637

Ingredient ID: NPC171928

Ingredient ID: NPC171741

Ingredient ID: NPC167976

Ingredient ID: NPC159150

Ingredient ID: NPC158367

Ingredient ID: NPC157571

Ingredient ID: NPC151543

Ingredient ID: NPC148593

Ingredient ID: NPC147247

Ingredient ID: NPC143168

Ingredient ID: NPC142415

Ingredient ID: NPC140505

Ingredient ID: NPC138839

Ingredient ID: NPC138261

Ingredient ID: NPC132345

Ingredient ID: NPC130577

Ingredient ID: NPC126753

Ingredient ID: NPC123796

Ingredient ID: NPC119628

Ingredient ID: NPC117668

Ingredient ID: NPC116850

Ingredient ID: NPC116232

Ingredient ID: NPC115601

Ingredient ID: NPC113733

Ingredient ID: NPC109183

Ingredient ID: NPC106701

Ingredient ID: NPC103947

Ingredient ID: NPC102990