• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Trichilia Claussenii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTGCCCCCCCCAACCCCAACCCCAACCCACTCTTGGGGGATGGTTGGACGGGCGGAAATTGGCCTCCCGTGCGCTCCCGCTCGCGGTTGGCCCAAATACGAGTCTTTCGGCGACCGTGTCGCGACGATCGGTGGTGTAACATGCCTCTCGAGCTCCCGTCGCGCACTCGCGTCTCCGTGCCACGGGCTCGCTGACCCTTGTAAGCGCTTTCTCTTCGAGACGGTGCTCGCT
Taxonomic Information

Plant ID: NPO3753
Plant Latin Name: Trichilia Claussenii
Taxonomy Genus: Trichilia
Taxonomy Family: Meliaceae

Plant External Links:

NCBI TaxonomyDB: 1640458
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC51700

Ingredient ID: NPC2967

Ingredient ID: NPC27184

Ingredient ID: NPC26960

Ingredient ID: NPC264317

Ingredient ID: NPC263414

Ingredient ID: NPC192638

Ingredient ID: NPC178383

Ingredient ID: NPC142415

Ingredient ID: NPC121162