• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ambrosia Tenuifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CCGTGAACAAGTAAAAACACCGGCCGAGCGGGGACCGATGCTTATGTTTCGATCCTTGTGAGGCCTTGTCGGCGTGTGTCCATTGTTGCACCATACATTTGGGCATCATGGATTTCACGGAGACACAATAACAAACCCCCGGCACGGTACGTGCCAAGGAAAACTAAACTTAAAGCGCCCGTGCTATTGCGCCCCGTTCGCGGTGTGCGCGTTGTATGTGGCGTCTTTGTTAAACCTAAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCATCCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCACCCCCACCAAACATCCCTTCTATGGACGTCTCTGGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGTGTGGTTGGCCTAAATAGGAGTCTCATCAAGAGAGACGCACGGCTAGTGGTGGTTGATAACACAGTCGTCTCATGTCGTGCGTTTTCATTCTTTGGTGTAGATGCTCTTAAAGTACCCTGACGCGTTGTCTTGCGATGATGCTTCGAT

Click for details-----ITS1

NA

Click for details-----ITS2

ATCACGTCACCCCCACCAAACATCCCTTCTATGGACGTCTCTGGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGTGTGGTTGGCCTAAATAGGAGTCTCATCAAGAGAGACGCACGGCTAGTGGTGGTTGATAACACAGTCGTCTCATGTCGTGCGTTTTCATTCTTTGGTGTAGATGCTCTTAAAGTACCCTGACGCGTTGTCTTGCGATGATGCTTCGAT
Taxonomic Information

Plant ID: NPO3718
Plant Latin Name: Ambrosia Tenuifolia
Taxonomy Genus: Ambrosia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 1532261
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Argentina

Traditional Medicine System:

Geographical Distribution

Argentina

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


4 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC41218

Ingredient ID: NPC264317

Ingredient ID: NPC20791

Ingredient ID: NPC183151

Ingredient ID: NPC179950

Ingredient ID: NPC169749

Ingredient ID: NPC159958

Ingredient ID: NPC129165

Ingredient ID: NPC116775

Ingredient ID: NPC113733