• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pyrus Communis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGAAGCATGGCGCAGGACGCTCCGAGGTAAATTGTATTAATAGGGCACGAGAATGCTTTTAGAGGCTAAGAAAATCAGACAATAGTTGCAATATTACTAAGGGGAGAAGGAGGCACCAAGACTCAAATCATCCAAAGAGTGCAAGAAGGGGAAGGTGAGGTTTTTTTTCTTCTTTTCGATGTTAGGGCGTTCTAACTTCTCCAGTCTGCTGTAGTCCTTGGGAACGATGCGCAGTAGGCACGTGTAGCCCTATTTCGAGAACCATAACGACTGTAGGCAACGGATATATCGGCTCTCGCATAGAAGAAGAACGCTGCACAATGCGATACTTGGTATGAATGGCTGAATTCCTTGAATCATCGAGTTTTTGAACGCAAGTTGCGACCGAATCCTTTCGACCGAGGGCACACATGCATGGGTGTCATGCAATAGTCGCCCCCAACCCTTTTGATACATCGATGAGGGGGGCGGATTATGGCCTCCCGTGCGCCTAGTGCATGCGGTTGGCGTAAAAATGGAGTCCCCGGCGACTATCGCCTCGGCAATAGGTGGTGTAAGACTCTCTGAAACTCCGTCCTCTCCTTTGGGGTGGTAAAACCGTACTATGGAAA

Click for details-----ITS1

AGAAGCATGGCGCAGGACGCTCCGAGGTAAATTGTATTAATAGGGCACGAGAATGCTTTTAGAGGCTAAGAAAATCAGACAATAGTTGCAATATTACTAAGGGGAGAAGGAGGCACCAAGACTCAAATCATCCAAAGAGTGCAAGAAGGGGAAGGTGAGGTTTTTTTTCTTCTTTTCGATGTTAGGGCGTTCTAACTTCTCCAGTCTGCTGTAGTCCTTGGGAACGATGCGCAGTAGGCACGTGTAGCCCTATTTCGAGAACCATAA

Click for details-----ITS2

GCCGTTGCTCCCCCGCGCCTCCCTCGGGAGAGCGTCGGGGGGCGGACGATGGCCTCCCGTGCGTCACCCCGCGCGGTTGGCACAAATGCCGGGTCCTCGGCGACGGACGCCACGACGATCGGTGGTTTCCCAACCTCGGTTGCATGTTGTGCGCTTTCGTCGCGCTCCGAGCGGCCCGCGACGCTCCCTGCCCTGCTTCGGCCGAGCTTTCAACG
Taxonomic Information

Plant ID: NPO366
Plant Latin Name: Pyrus Communis
Taxonomy Genus: Pyrus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 23211
Plant-of-the-World-Online: 30065762-2

Used in Medicines

Country/Region:
Turkey; Italy; India

Traditional Medicine System:


Medicinal Functions:

Astringent; Febrifuge; Sedative

Geographical Distribution

Canada; Turkey; Italy; Turkmenistan; France; Georgia; Ireland; Ecuador; Uzbekistan; Australia; Germany; Belgium; Iraq; Kazakhstan; Spain; Ukraine; Netherlands; Denmark; Poland; United States; Sweden; Belarus; Switzerland; Russia; Romania; Albania; South Africa; Tajikistan; India; United Kingdom; Austria; Greece; Hungary; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

116 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


70 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

77 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC86851

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC81010

Ingredient ID: NPC6984

Ingredient ID: NPC68903

Ingredient ID: NPC68779

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC58629

Ingredient ID: NPC58190

Ingredient ID: NPC55711

Ingredient ID: NPC55412

Ingredient ID: NPC51843

Ingredient ID: NPC51260

Ingredient ID: NPC49126

Ingredient ID: NPC491218

Ingredient ID: NPC490459

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490411

Ingredient ID: NPC490383

Ingredient ID: NPC490344

Ingredient ID: NPC489907

Ingredient ID: NPC48645

Ingredient ID: NPC48623

Ingredient ID: NPC47596

Ingredient ID: NPC424

Ingredient ID: NPC40965

Ingredient ID: NPC38779

Ingredient ID: NPC3693

Ingredient ID: NPC34910

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC313528

Ingredient ID: NPC313179

Ingredient ID: NPC312800

Ingredient ID: NPC312022

Ingredient ID: NPC294902

Ingredient ID: NPC294558

Ingredient ID: NPC294548

Ingredient ID: NPC290319

Ingredient ID: NPC289758

Ingredient ID: NPC284918

Ingredient ID: NPC281686

Ingredient ID: NPC281131

Ingredient ID: NPC279406

Ingredient ID: NPC278068

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC2660

Ingredient ID: NPC264756

Ingredient ID: NPC261831

Ingredient ID: NPC257582

Ingredient ID: NPC257350

Ingredient ID: NPC246558

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC236472

Ingredient ID: NPC236202

Ingredient ID: NPC228346

Ingredient ID: NPC228333

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225434

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC218108

Ingredient ID: NPC213876

Ingredient ID: NPC211442

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC199072

Ingredient ID: NPC192229

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC182777

Ingredient ID: NPC179950

Ingredient ID: NPC179491

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC169522

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC163040

Ingredient ID: NPC154014

Ingredient ID: NPC153713

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC1507

Ingredient ID: NPC147983

Ingredient ID: NPC143211

Ingredient ID: NPC142319

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC126029

Ingredient ID: NPC125733

Ingredient ID: NPC125062

Ingredient ID: NPC120649

Ingredient ID: NPC118534

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111897

Ingredient ID: NPC108811

Ingredient ID: NPC1042