CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Achillea Pseudopectinata

Example Image

PLANiTS DNA barcode

TCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTAAAAACAACTGAGCRTCGAGTGGACTAAGCATCTGTTTGATCCTCTCGATGCTTTGTCGATGTGCATTCACTTGCGTTCTTTTTTGGACCTGGTGAATGTGTCATTGACGCAATAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTTGAGAAGGCTTGTTTCATGTAGCCCCGTTCGCGGTGCGCTCATGGAATGTGGCTTCTTTTTAATTTACAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO3658
Plant Latin Name: Achillea Pseudopectinata
Taxonomy Genus: Achillea
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 282760
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

47 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

24 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)