CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Solanum Aethiopicum

Example Image

PLANiTS DNA barcode

Click for details-----ITS

AAGGATCATTGTCGAATCCCGCAACGAGCAGACCGCGCACACGTATAAGCTGCATGGGGCACCCGATGGGAAGGTGCGCGTGCGCCTCCCGTTGGTTTGCTCCGCACCCCCGGCCGATACCCTCGCGCGAGCGAGTGCAACAGGCTGGGCCATTAACAGACCCACGGCGTATTACGGCGCCAAGGATCACAAACGCGGAGCGCTGCCCTCGTCGTGCACCCGTTCGTGGTGTGCCGTTCGGGGGATGTGCGTCTCCCAAGATTGCATACGGAAAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCTCCGCGCCCACCTCCCCACCCGGGGACGCGGGATGCGGGGCGGAGACTGGTCTCCCGTGCGCCCCGGCGCGCGGATGGCTAAAATGGGATCCCTCGGCGACGCACGTCACGGCCATTGGTGGTTGATCTCTCGTAAGTCGACTCGTGTGTGGTTGTGCTCCTCTGCATCGCTCGCGAGGGCATCCGAGCGTACCCAACGGCGCCTGGCGCCTGCATCCGCGACCCCA

Click for details-----ITS1

Click for details-----ITS2

ATCGCGTCGCTCCGCGCCCACCTCCCCACCCGGGGACGCGGGATGCGGGGCGGAGACTGGTCTCCCGTGCGCCCCGGCGCGCGGATGGCTAAAATGGGATCCCTCGGCGACGCACGTCACGGCCATTGGTGGTTGATCTCTCGTAAGTCGACTCGTGTGTGGTTGTGCTCCTCTGCATCGCTCGCGAGGGCATCCGAGCGTACCCAACGGCGCCTGGCGCCTGCATCCGCGACCCCA

Taxonomic Information

Plant ID: NPO3628
Plant Latin Name: Solanum Aethiopicum
Taxonomy Genus: Solanum
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 205524
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

100 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

92 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98340

Ingredient ID: NPC97965

Ingredient ID: NPC97632

Ingredient ID: NPC97455

Ingredient ID: NPC92573

Ingredient ID: NPC89102

Ingredient ID: NPC88150

Ingredient ID: NPC86541

Ingredient ID: NPC7934

Ingredient ID: NPC77338

Ingredient ID: NPC74923

Ingredient ID: NPC6984

Ingredient ID: NPC63632

Ingredient ID: NPC61076

Ingredient ID: NPC5796

Ingredient ID: NPC51743

Ingredient ID: NPC46072

Ingredient ID: NPC46056

Ingredient ID: NPC37818

Ingredient ID: NPC312592

Ingredient ID: NPC310491

Ingredient ID: NPC309778

Ingredient ID: NPC306418

Ingredient ID: NPC303693

Ingredient ID: NPC302416

Ingredient ID: NPC301632

Ingredient ID: NPC300561

Ingredient ID: NPC299401

Ingredient ID: NPC298215

Ingredient ID: NPC290864

Ingredient ID: NPC289032

Ingredient ID: NPC288656

Ingredient ID: NPC285391

Ingredient ID: NPC282635

Ingredient ID: NPC281220

Ingredient ID: NPC280381

Ingredient ID: NPC279870

Ingredient ID: NPC276673

Ingredient ID: NPC276516

Ingredient ID: NPC27460

Ingredient ID: NPC271450

Ingredient ID: NPC270348

Ingredient ID: NPC270028

Ingredient ID: NPC26960

Ingredient ID: NPC263662

Ingredient ID: NPC261962

Ingredient ID: NPC259459

Ingredient ID: NPC259182

Ingredient ID: NPC255488

Ingredient ID: NPC2514

Ingredient ID: NPC249910

Ingredient ID: NPC249012

Ingredient ID: NPC246172

Ingredient ID: NPC238520

Ingredient ID: NPC236224

Ingredient ID: NPC230747

Ingredient ID: NPC228401

Ingredient ID: NPC227750

Ingredient ID: NPC220053

Ingredient ID: NPC219306

Ingredient ID: NPC216692

Ingredient ID: NPC215835

Ingredient ID: NPC214907

Ingredient ID: NPC212442

Ingredient ID: NPC20550

Ingredient ID: NPC200294

Ingredient ID: NPC198706

Ingredient ID: NPC196795

Ingredient ID: NPC196636

Ingredient ID: NPC191474

Ingredient ID: NPC190027

Ingredient ID: NPC180855

Ingredient ID: NPC174812

Ingredient ID: NPC171538

Ingredient ID: NPC165973

Ingredient ID: NPC164935

Ingredient ID: NPC160525

Ingredient ID: NPC156433

Ingredient ID: NPC154866

Ingredient ID: NPC15447

Ingredient ID: NPC149115

Ingredient ID: NPC145294

Ingredient ID: NPC143591

Ingredient ID: NPC142752

Ingredient ID: NPC137797

Ingredient ID: NPC131489

Ingredient ID: NPC128425

Ingredient ID: NPC128174

Ingredient ID: NPC126368

Ingredient ID: NPC125359

Ingredient ID: NPC12421

Ingredient ID: NPC123034

Ingredient ID: NPC122121

Ingredient ID: NPC108348

Ingredient ID: NPC107325

Ingredient ID: NPC105539

Ingredient ID: NPC102889

Ingredient ID: NPC101733

Ingredient ID: NPC100395

Ingredient ID: NPC100037

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Drug Transporter	SLC superfamily of solute carriers	SLC5A1	Sodium/glucose cotransporter 1	P13866	CHEMBL4979
Drug Transporter	SLC superfamily of solute carriers	SLC5A4	Low affinity sodium-glucose cotransporter	Q9NY91	CHEMBL1770047
Drug Transporter	SLC superfamily of solute carriers	SLC5A2	Sodium/glucose cotransporter 2	P31639	CHEMBL3884

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	SLC5A4,SLC5A1,SLC5A2
Type-1/2 diabete Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10-5A11	SLC5A4,SLC5A2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	SLC5A1,SLC5A2
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	SLC5A2,SLC5A1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	SLC5A2,SLC5A4
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	SLC5A2,SLC5A1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	SLC5A2,SLC5A1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	SLC5A2,SLC5A1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	SLC5A2,SLC5A4
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	SLC5A2,SLC5A1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	SLC5A4,SLC5A1
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	SLC5A2
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	SLC5A2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	SLC5A4
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	SLC5A2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	SLC5A1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	SLC5A2
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	SLC5A1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	SLC5A2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	SLC5A1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	SLC5A1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	SLC5A2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	SLC5A2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Solanum Aethiopicum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

100 All known Ingredients in Total

92 Ingredients with Acceptable Bioavailablity

6 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Type 2 diabetes mellitus

Type-1/2 diabete

Cardiovascular disease

Diabetes mellitus, type unspecified

Acute diabete complication

Heart failure

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Other specified malignant neoplasms of kidney, except renal pelvis

Chronic kidney disease

Liver disease

Hepatoblastoma

Adenocarcinoma of stomach

Adenocarcinoma of pancreas

Mesothelioma of pleura

Urothelial carcinoma of bladder

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Malignant neoplasms of thymus

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities