CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Ilex Hainanensis

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTGCAAAATAGACCCGGCGAACTTGTTAAAATATGCCTGGGGGTTTGAGAAAGGGTGCGCGAGCCCCCCACCCCACTCCCCCAGCCCCTTGGGGATTGGGCTGCGTTTCCCTTACCGGGGATTGGTCCAAGTTCCGGCCACGGAACCCGGGCGTATTTTGCGCCAGGGACCCTTAATGGAAGGGTGGCCTTCCGGATTTCCCTTTGGGGGTGGGCACGGGAGGCATTTGCATCTTTTGAATCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCTAAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCACCAACCCCAATGCCCAGCTGGATATTGCGGGAGTTGGGGGCGGAAATTGGCCTCCCGTCCACGAACGTGCGCGGTTGGCCCAAAAAATGAGTTCTTGACGATGGACGTCACGGCAAGTGGTGGTTGAAAGACCTCTTGCGTCATGTCGTGAGGCACCAAGTCTGTAGCGAGCTCTGACCGCGACCCTGTGCACCCTTCCTTCACGGATGGTGCTCCGACCGCGACCCCAGTCAGACGGATAGCCACTAGTT

Click for details-----ITS1

TTGTCGATGCCTGCAAAATAGACCCGGCGAACTTGTTAAAATATGCCTGGGGGTTTGAGAAAGGGTGCGCGAGCCCCCCACCCCACTCCCCCAGCCCCTTGGGGATTGGGCTGCGTTTCCCTTACCGGGGATTGGTCCAAGTTCCGGCCACGGAACCCGGGCGTATTTTGCGCCAGGGACCCTTAATGGAAGGGTGGCCTTCCGGATTTCCCTTTGGGGGTGGGCACGGGAGGCATTTGCATCTTTTGAATCTAAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO3619
Plant Latin Name: Ilex Hainanensis
Taxonomy Genus: Ilex
Taxonomy Family: Aquifoliaceae

Plant External Links:

NCBI TaxonomyDB: 1043421
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

23 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC74210

Ingredient ID: NPC74054

Ingredient ID: NPC4446

Ingredient ID: NPC4103

Ingredient ID: NPC307248

Ingredient ID: NPC298234

Ingredient ID: NPC277216

Ingredient ID: NPC27230

Ingredient ID: NPC270768

Ingredient ID: NPC246943

Ingredient ID: NPC19240

Ingredient ID: NPC190243

Ingredient ID: NPC178134

Ingredient ID: NPC149184

Ingredient ID: NPC146681

Ingredient ID: NPC14030

Ingredient ID: NPC139548

Ingredient ID: NPC1321

Ingredient ID: NPC125164

Ingredient ID: NPC116857

Ingredient ID: NPC116775

Ingredient ID: NPC111929

Ingredient ID: NPC10564

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Enzyme	HPGD	15-hydroxyprostaglandin dehydrogenase [NAD+]	P15428	CHEMBL1293255
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Other cytosolic protein	HSPA1A	Heat shock 70 kDa protein 1	P0DMV8	CHEMBL5460
Therapeutic Target	Oxidoreductase	AKR1B1	Aldose reductase	P15121	CHEMBL1900
Therapeutic Target	Oxidoreductase	HSD17B2	Estradiol 17-beta-dehydrogenase 2	P37059	CHEMBL2789
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	TEK	Tyrosine-protein kinase TIE-2	Q02763	CHEMBL4128
Therapeutic Target	Protein Kinase	SRC	Tyrosine-protein kinase SRC	P12931	CHEMBL267
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	NUAK1	NUAK family SNF1-like kinase 1	O60285	CHEMBL5784
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	EGFR	Epidermal growth factor receptor erbB1	P00533	CHEMBL203
Therapeutic Target	Protein Kinase	INSR	Insulin receptor	P06213	CHEMBL1981
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Drug Transporter	SLC superfamily of solute carriers	SLC22A6	Solute carrier family 22 member 6	Q4U2R8	CHEMBL1641347
Drug Transporter	SLC superfamily of solute carriers	SLCO1B3	Solute carrier organic anion transporter family member 1B3	Q9NPD5	CHEMBL1743121
Therapeutic Target	Small molecule receptor (family A GPCR)	GPR35	G-protein coupled receptor 35	Q9HC97	CHEMBL1293267
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081
Therapeutic Target	Transcription factor	SMAD3	Mothers against decapentaplegic homolog 3	P84022	CHEMBL1293258
Therapeutic Target	Transcription factor	AHR	Aryl hydrocarbon receptor	P35869	CHEMBL3201
Therapeutic Target	Transferase	POLH	DNA polymerase eta	Q9Y253	CHEMBL5542
Therapeutic Target	Transferase	POLI	DNA polymerase iota	Q9UNA4	CHEMBL5391

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	2

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Ellagic Acid (NPC178134)	NP level
NCT04011618	Effect of Ellagic Ácid on the Components of Metabolic Syndrome, Insulin Sensitivity and Insulin Secretion	metabolic syndrome	Ellagic Acid (NPC178134)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	TEK,IGF1R,SRC,MET,KDR,CA12,EGFR
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,CSNK2A3,DPP4,CYP1B1,KDR,POLH,MET
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,DPP4,CA7,CYP3A4,HPGD,MET,HSD17B2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12,NUAK1,SRC,AKR1B1,IGF1R,GPR35
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	KDM4E,HPGD,GPR35,ELAVL3,CYP2C9,CYP1A1
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	HSPA1A,EGFR,HSPA1B,MET,KDR
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	EGFR,IGF1R,MET,KDR,CSNK2A1
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	AHR,IGF1R,INSR,SRC,KDR
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,GPR35,SLC22A6,CA12,SRC
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AKR1B1,CYP3A4,SLCO1B3,CYP1A2,CYP2C9
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,DPP4,CYP1B1,CA7,MET
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,GPR35,SLCO1B3,CA7,CYP2C9
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	GPR35,SLCO1B3,CYP2C9,HSD17B2,CYP1A1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CYP3A4,CYP1A2,MET,CYP1A1
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	HSPA1A,SRC,HSPA1B,IGF1R
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	SRC,IGF1R,F3,EGFR
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	IGF1R,KDR,EGFR,MET
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	TYR,EGFR,KDR,MET
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR,IGF1R,EGFR,MET
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	MET,EGFR,SRC,KDR
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	HSPA1B,HSPA1A,KDR,SRC
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	INSR,KDR,DPP4,AKR1B1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	TYR,CYP2C9,MET,GPR35
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,SLCO1B3,CA7,CYP2C9
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	TYR,SLCO1B3,MET,CYP1A1
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	EGFR,HSPA1A,HSPA1B
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	APEX1,IGF1R,TEK
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	SRC,MET,KDR
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	HSPA1B,SRC,HSPA1A
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MET,EGFR,KDR
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	HSPA1B,SMAD3,HSPA1A
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1,HSPA1A,HSPA1B
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	MET,EGFR,KDR
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	MET,KDR,SRC
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	KDR,SRC,MET
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	EGFR,AHR,KDR
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	INSR,MET,KDR
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4,TEK,MET
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1,INSR,IGF1R
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	EGFR,KDR,MET
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	KDR,MET,EGFR
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	DPP4,SRC,INSR
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	F3,EGFR,GPR35
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	DPP4,SMAD3,CYP1B1
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	INSR SLCO1B3
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	INSR,DPP4
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	KDR,AHR
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KDR,SRC
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	DPP4,SRC
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	EGFR,MET
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	HSPA1A,HSPA1B
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	AHR,DPP4
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	TEK,SRC
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CYP2C9,CA12
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	SRC,EGFR
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	MET,KDR
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4 NCT04011618
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR,SRC
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	SRC,KDR
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	CYP3A4,AHR
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	EGFR,KDR
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	MET,AKR1B1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	INSR,DPP4
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ELAVL3,MET
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12,HSD17B2
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	DPP4,AKR1B1
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	SLCO1B3,MET
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	HPGD,CYP1A1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	DPP4,MET
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,SLCO1B3
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	SLCO1B3,HSPA1A
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	F3,CYP1A1
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	POLH,HPGD
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,ELAVL3
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	MET,GPR35
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	MET,HSD17B2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	RECQL,HSD17B10,EGFR,APEX1,AHR,MET,CA12,TDP1,AKR1B1,KDR,SRC,CISD1,CSNK2A2,F3,CSNK2A1,NUAK1,TEK,POLH
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	RECQL,GALNT2,EGFR,HPGD,APEX1,AHR,MET,CA12,TDP1,TYR,KDR,CA7,HSD17B2,DPP4,SRC,CSNK2A2,POLH
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	EGFR,IGF1R,CYP3A4,POLB,HSPA1B,CA12,F3,CSNK2A1,APEX1,MET,TEK,AHR,HSPA1A,SRC,KDR
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CSNK2A3,CSNK2A1,TDP1,CISD1,HPGD,SLCO1B3,ELAVL3,CYP1A2,APEX1,POLH,MET,HSD17B2,AHR
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,DPP4,NUAK1,AKR1B1,SMAD3,TEK,HPGD,RAD52,SLC22A6,KDR,AHR,CYP2C9,MET,HSD17B2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	DPP4,RECQL,NUAK1,POLB,CISD1,TEK,SLCO1B3,CYP1B1,CA7,CYP2C9,MET,HSD17B2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	DPP4,TDP1,GALNT2,POLB,HSD17B10,AKR1B1,CA7,CISD1,ELAVL3,MET,HSD17B2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	DPP4,GALNT2,AKR1B1,HSD17B10,CISD1,CYP3A4,HPGD,CYP1B1,APEX1,CYP2C9,HSD17B2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CSNK2A3,F3,CSNK2A1,NUAK1,SRC,AKR1B1,SMAD3,IGF1R,GPR35,ELAVL3
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	SRC
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	TYR
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
NA Disease Category: NA Disease ICD-11 Code: NA	MET
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	INSR
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	TEK
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Ocular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D00-2D07	APEX1
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Lysosomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C56	INSR
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	SRC
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	SRC
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Type-1/2 diabete Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10-5A11	INSR
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
Ureteral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C92	AHR
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	EGFR
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	SRC
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	IGF1R
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SRC
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	SRC
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	CYP3A4
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	SRC
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	NCT00455416
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	CYP2C9
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	SLCO1B3
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	SMAD3
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	SLCO1B3
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	SLCO1B3
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F3
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	IGF1R
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	SLCO1B3
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AHR

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Ilex Hainanensis

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

23 All known Ingredients in Total

6 Ingredients with Acceptable Bioavailablity

11 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Breast cancer

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Hepatoblastoma

Cytomegaloviral disease

Stomach cancer

Liver cancer

Multiple myeloma

Hepatocellular carcinoma of liver

Urothelial carcinoma of bladder

Malignant neoplasms of thyroid gland, unspecified

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Renal cell carcinoma, chromophobe type

Motor neuron disease

Pancreatic cancer

Colorectal cancer

Melanoma

Lung cancer

Brain cancer

Malignant digestive organ neoplasm

Acute diabete complication

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Other specified malignant neoplasms ofcolon

Diabetic foot ulcer

Retinopathy

Ovarian cancer

BCR-ABL1-negative chronic myeloid leukaemia

Head and neck cancer

Herpes simplex infection

Neuropathy

Non-small cell lung cancer

Pleomorphic sarcoma

Cardiovascular disease

Myelodysplastic syndrome

Alzheimer disease

Chronic arterial occlusive disease

Pain, unspecified

Renal cell carcinoma

Metastatic lymph node neoplasm

Superficial ovarian endometriosis

Chikungunya virus disease

Carpal tunnel syndrome

Crohn disease

Type 2 diabetes mellitus

Thrombocytopenia

Gastrointestinal stromal tumour

Malignant haematopoietic neoplasm

Unspecific body region injury

Metastatic malignant neoplasm

Psoriasis

Myeloproliferative neoplasm

Bacterial infection

Mature B-cell leukaemia

Thyroid cancer

Metabolic disorder

Ischemia

Peritoneal cancer

Atopic eczema

Chronic pain

Glaucoma

Diabetes mellitus, type unspecified

Pheochromocytoma