• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Argemone Mexicana


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAACGACCCGTGAACACGTGAAGCCAAGTTCAGTGGGACGGCAAGGGGAGTGATCCCATTGCCTTACCGCTTCGGCCGGGACTTGGGTGTGAGCCCACTGTTCCTTGCCGAACAACGAACCCAAGGCGCGGCAAGCGCCAAGGAACAAACAAACGGAAACGACGCGGTGCCCCCGTTCTCCAGCCTTGGTGGGCGAAATGCAGCGGGTGCCGTAGCGAGATCCGATCTTCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCCAAGCCTCCGGGCCGAGGGCACGCCTGCCTGGGCGTCACGCACCGAGTCGCCCCCACTCCCGACTTTGTCCTTGCGACATGGCCGGCGAATAGTCTGGGGCGGAGATTGGCCCCCCGTGCCTCGCGGTGCGGTCGGCCCAAACGAGGGCCCCTTGGCGGCCAACGTCACGATTCGTGGTGGTCGACAATAACGTTGTCTTATCCGAAATCCGTGTGCGTTGTGCCGCTGTGAAAGGCCACCAGACCCCATCGGGCCGTTTTCACGGCACCCACTCT

Click for details-----ITS1

TCGAAACCTGCCTAGCAGAACGACCCGTGAACACGTGAAGCCAAGTTCAGTGGGACGGCAAGGGGAGTGATCCCATTGCCTTACCGCTTCGGCCGGGACTTGGGTGTGAGCCCACTGTTCCTTGCCGAACAACGAACCCAAGGCGCGGCAAGCGCCAAGGAACAAACAAACGGAAACGACGCGGTGCCCCCGTTCTCCAGCCTTGGTGGGCGAAATGCAGCGGGTGCCGTAGCGAGATCCGATCTTCAAA

Click for details-----ITS2

ACCGAGTCGCCCCCACTCCCGACTTTGTCCTTGCGACATGGCCGGCGAATAGTCTGGGGCGGAGATTGGCCCCCCGTGCCTCGCGGTGCGGTCGGCCCAAACGAGGGCCCCTTGGCGGCCAACGTCACGATTCGTGGTGGTCGACAATAACGTTGTCTTATCCGAAATCCGTGTGCGTTGTGCCGCTGTGAAAGGCCACCAGACCCCATCGGGCCGTTTTCACGGCACCCACTCT
Taxonomic Information

Plant ID: NPO3504
Plant Latin Name: Argemone Mexicana
Taxonomy Genus: Argemone
Taxonomy Family: Papaveraceae

Plant External Links:

NCBI TaxonomyDB: 54796
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Tanzania; India; Rwanda; China; Kenya; Nigeria

Traditional Medicine System:
Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Alterative; Analgesic; Antispasmodic; Antitussive; Demulcent; Emetic; Expectorant; Hallucinogenic; Purgative; Sedative; Skin; Warts

Geographical Distribution

Tanzania; India; Rwanda; China; Kenya; Nigeria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

25 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


20 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC86469

Ingredient ID: NPC67978

Ingredient ID: NPC65196

Ingredient ID: NPC50736

Ingredient ID: NPC43573

Ingredient ID: NPC41178

Ingredient ID: NPC38072

Ingredient ID: NPC31821

Ingredient ID: NPC315274

Ingredient ID: NPC314828

Ingredient ID: NPC307065

Ingredient ID: NPC303581

Ingredient ID: NPC286342

Ingredient ID: NPC284428

Ingredient ID: NPC238530

Ingredient ID: NPC23614

Ingredient ID: NPC23080

Ingredient ID: NPC193906

Ingredient ID: NPC190944

Ingredient ID: NPC183485

Ingredient ID: NPC150725

Ingredient ID: NPC135006

Ingredient ID: NPC121400

Ingredient ID: NPC109042

Ingredient ID: NPC100079