• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Viguiera Decurrens


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCACAGCAGAACGACCCGTGAACAAGTTAACACATCTGCCCTTSCGAGGACCGAAGCATTTGTTTCGGGCCTTGTGAGGCCTTGTCGACGTGCGTTCATGCRTGCCCCATACCTTTGGTGCATCRTGGATGTCATGTTGACGAAATAACAAACCCCCGGCACGAGACGTGCCAAGGAAAACCAAAATTAAAGGGCCCGTGCTGTTGCGCCCCGTTCGCGGTGTGCGCGTTGGACGYGGCTTCTTTGTAAACTTAAAAYGACTCTCGGCAACGGATATCTCGGCTCAYGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCCCACCAGGCATCCCTTATAGGGTTGTCTTGTGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGCGTGGTTGGCCTAAATAGGAGTCTCCTCATGAGGGACGCACGACTAGTGGTGGTTGATAAGACTGTCGTCTCGTGTTGTGCGTTTACTTTCTTGAGTGTAGATGCTCTTAAAGTACCTCGATGTGTTGTCTTTTGACGATGCTTCGATC

Click for details-----ITS1

TCGAACCCTGCACAGCAGAACGACCCGTGAACAAGTTAACACATCTGCCCTTSCGAGGACCGAAGCATTTGTTTCGGGCCTTGTGAGGCCTTGTCGACGTGCGTTCATGCRTGCCCCATACCTTTGGTGCATCRTGGATGTCATGTTGACGAAATAACAAACCCCCGGCACGAGACGTGCCAAGGAAAACCAAAATTAAAGGGCCCGTGCTGTTGCGCCCCGTTCGCGGTGTGCGCGTTGGACGYGGCTTCTTTGTAAACTTAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO3408
Plant Latin Name: Viguiera Decurrens
Taxonomy Genus: Viguiera
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 1048926
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Mexico

Traditional Medicine System:

Geographical Distribution

Mexico

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

167 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


91 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

65 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9874

Ingredient ID: NPC95126

Ingredient ID: NPC91386

Ingredient ID: NPC90105

Ingredient ID: NPC86753

Ingredient ID: NPC86438

Ingredient ID: NPC80807

Ingredient ID: NPC80600

Ingredient ID: NPC80374

Ingredient ID: NPC79499

Ingredient ID: NPC79391

Ingredient ID: NPC78946

Ingredient ID: NPC78026

Ingredient ID: NPC77974

Ingredient ID: NPC76296

Ingredient ID: NPC76145

Ingredient ID: NPC72422

Ingredient ID: NPC72017

Ingredient ID: NPC71853

Ingredient ID: NPC70744

Ingredient ID: NPC70100

Ingredient ID: NPC68779

Ingredient ID: NPC68617

Ingredient ID: NPC68014

Ingredient ID: NPC67571

Ingredient ID: NPC66399

Ingredient ID: NPC65942

Ingredient ID: NPC64123

Ingredient ID: NPC62086

Ingredient ID: NPC58190

Ingredient ID: NPC57788

Ingredient ID: NPC50763

Ingredient ID: NPC48744

Ingredient ID: NPC48107

Ingredient ID: NPC47844

Ingredient ID: NPC43436

Ingredient ID: NPC42676

Ingredient ID: NPC40147

Ingredient ID: NPC39896

Ingredient ID: NPC37468

Ingredient ID: NPC37288

Ingredient ID: NPC36616

Ingredient ID: NPC3649

Ingredient ID: NPC35741

Ingredient ID: NPC33090

Ingredient ID: NPC32553

Ingredient ID: NPC311881

Ingredient ID: NPC307574

Ingredient ID: NPC307506

Ingredient ID: NPC307110

Ingredient ID: NPC307050

Ingredient ID: NPC299937

Ingredient ID: NPC299856

Ingredient ID: NPC299529

Ingredient ID: NPC297727

Ingredient ID: NPC297011

Ingredient ID: NPC29598

Ingredient ID: NPC295946

Ingredient ID: NPC294952

Ingredient ID: NPC293908

Ingredient ID: NPC293017

Ingredient ID: NPC292722

Ingredient ID: NPC291789

Ingredient ID: NPC290016

Ingredient ID: NPC289688

Ingredient ID: NPC288436

Ingredient ID: NPC287301

Ingredient ID: NPC280642

Ingredient ID: NPC278434

Ingredient ID: NPC273991

Ingredient ID: NPC269613

Ingredient ID: NPC268342

Ingredient ID: NPC263281

Ingredient ID: NPC26314

Ingredient ID: NPC261093

Ingredient ID: NPC26080

Ingredient ID: NPC251102

Ingredient ID: NPC250482

Ingredient ID: NPC249340

Ingredient ID: NPC246581

Ingredient ID: NPC246202

Ingredient ID: NPC246162

Ingredient ID: NPC246005

Ingredient ID: NPC244776

Ingredient ID: NPC244442

Ingredient ID: NPC243728

Ingredient ID: NPC242898

Ingredient ID: NPC241784

Ingredient ID: NPC238809

Ingredient ID: NPC237207

Ingredient ID: NPC23682

Ingredient ID: NPC23678

Ingredient ID: NPC236202

Ingredient ID: NPC232375

Ingredient ID: NPC232227

Ingredient ID: NPC228346

Ingredient ID: NPC227632

Ingredient ID: NPC224390

Ingredient ID: NPC223834

Ingredient ID: NPC222001

Ingredient ID: NPC219876

Ingredient ID: NPC219480

Ingredient ID: NPC218943

Ingredient ID: NPC218792

Ingredient ID: NPC217650

Ingredient ID: NPC215647

Ingredient ID: NPC212866

Ingredient ID: NPC211336

Ingredient ID: NPC210532

Ingredient ID: NPC21002

Ingredient ID: NPC206280

Ingredient ID: NPC203719

Ingredient ID: NPC197285

Ingredient ID: NPC191327

Ingredient ID: NPC191271

Ingredient ID: NPC188238

Ingredient ID: NPC18816

Ingredient ID: NPC187272

Ingredient ID: NPC187169

Ingredient ID: NPC186616

Ingredient ID: NPC185768

Ingredient ID: NPC182453

Ingredient ID: NPC181664

Ingredient ID: NPC178919

Ingredient ID: NPC178815

Ingredient ID: NPC178582

Ingredient ID: NPC173883

Ingredient ID: NPC172469

Ingredient ID: NPC172195

Ingredient ID: NPC169468

Ingredient ID: NPC165219

Ingredient ID: NPC163332

Ingredient ID: NPC163326

Ingredient ID: NPC163191

Ingredient ID: NPC162521

Ingredient ID: NPC15658

Ingredient ID: NPC156304

Ingredient ID: NPC15518

Ingredient ID: NPC15482

Ingredient ID: NPC153854

Ingredient ID: NPC152600

Ingredient ID: NPC151439

Ingredient ID: NPC150361

Ingredient ID: NPC148615

Ingredient ID: NPC148174

Ingredient ID: NPC142871

Ingredient ID: NPC141733

Ingredient ID: NPC140201

Ingredient ID: NPC139397

Ingredient ID: NPC138370

Ingredient ID: NPC138113

Ingredient ID: NPC130754

Ingredient ID: NPC128248

Ingredient ID: NPC12640

Ingredient ID: NPC125665

Ingredient ID: NPC116272

Ingredient ID: NPC114239

Ingredient ID: NPC113614

Ingredient ID: NPC112959

Ingredient ID: NPC111929

Ingredient ID: NPC111275

Ingredient ID: NPC111212

Ingredient ID: NPC108811

Ingredient ID: NPC107815

Ingredient ID: NPC10716

Ingredient ID: NPC107091

Ingredient ID: NPC100844