• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Byrsonima Coccolobifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGCAGACGACTCGCGAACCGTGGTTACACTGCGTCGAGGGGCGACGGGGCCACCGCCCCCCGCCCCTCGGCAAAAGTCCCGGGAGGCGCCGGAGGCAAGCGCCTCGGGCGCCCGACGGGACTCTCAACCAAACCCCGGCGCAGAACGCGCCAAGGAAAACGAAATCGAGGAGGACCGTCCCTGCGCTCCCGGAGACGGCGCGCGCTCGGACGGTCCGCCGGACAGTCACGAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACACAACGTTGTCCCACCACAAACCCATCCCGAGAGGGAAGGGAGGGACGGATACTGGTCTCCCGTGAGTCACCCCTCGCGGCTGGCCCAAACGCATGTCCGCGAGACGGGAGCCGCGACTAACGGTGGTTGAACGACCCTCGGCTCAGGTCGCGGCCCCCCGTCCCGAGAGCGGGCAACGAGACCCCGCGCGTCGCTTGGAACGCCACAA

Click for details-----ITS1

NA

Click for details-----ITS2

AACGTTGTCCCACCACAAACCCATCCCGAGAGGGAAGGGAGGGACGGATACTGGTCTCCCGTGAGTCACCCCTCGCGGCTGGCCCAAACGCATGTCCGCGAGACGGGAGCCGCGACTAACGGTGGTTGAACGACCCTCGGCTCAGGTCGCGGCCCCCCGTCCCGAGAGCGGGCAACGAGACCCCGCGCGTCGCTTGGAACGCCACAA
Taxonomic Information

Plant ID: NPO33509
Plant Latin Name: Byrsonima Coccolobifolia
Taxonomy Genus: Byrsonima
Taxonomy Family: Malpighiaceae

Plant External Links:

NCBI TaxonomyDB: 1027102
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

17 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


5 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC471746

Ingredient ID: NPC471745

Ingredient ID: NPC471744

Ingredient ID: NPC290601

Ingredient ID: NPC265530

Ingredient ID: NPC219904

Ingredient ID: NPC219876

Ingredient ID: NPC20791

Ingredient ID: NPC181250

Ingredient ID: NPC179950

Ingredient ID: NPC177839

Ingredient ID: NPC173637

Ingredient ID: NPC169749

Ingredient ID: NPC153342

Ingredient ID: NPC141765

Ingredient ID: NPC126029

Ingredient ID: NPC113968