• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Caesalpinia Volkensii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TGCGGAAGGATCATTGTCGATGCCTCTAAAACAGAAAGACCCGTGAACTGTGCAGTCATTATTTGGGGAGGCGGGGTGCTTGTCGCCCTAGGCCCCCCGTGTCAGTGAGAGCGCTTGCAGAATCATTCTGCTCGTCCATCATTGATGCAACAACTAACCCCGGCGCACTGCGCCAAGGAATTTTGAAAAAAAAGCGTGCCCCCCGACAGCCCGGAGACGGTGCGGGTTGGGGAGTGTTGCGTCATACATATACATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO33322
Plant Latin Name: Caesalpinia Volkensii
Taxonomy Genus: Caesalpinia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1387603
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Kenya; Tanzania; Rwanda; India

Traditional Medicine System:

Geographical Distribution

Kenya; Tanzania; Rwanda; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

10 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC471152

Ingredient ID: NPC46912

Ingredient ID: NPC307401

Ingredient ID: NPC272015

Ingredient ID: NPC263337

Ingredient ID: NPC2482

Ingredient ID: NPC230301

Ingredient ID: NPC228842

Ingredient ID: NPC142415

Ingredient ID: NPC113733