• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Anchusa Strigosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GAATCCTGCATAGCCGAACCACTCGTGAATAAGTTAGTAACAAATATGGCATTATGGTCTGTGGGTATACCTTACATTCTAGTGTGCCTCATGGTGCTTGGGCATTTTGCCTCTGTGCTTAACAAAACCCCGGCGTGATAAGCGCCAAGGATTACTATACCATGTGTCTTAACTTTTCTCTCCCATTAAAGGGACCAAGAGGATTGGGATGGATTCTATATAAACAACAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO3209
Plant Latin Name: Anchusa Strigosa
Taxonomy Genus: Anchusa
Taxonomy Family: Boraginaceae

Plant External Links:

NCBI TaxonomyDB: 256480
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

8 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

3 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC84830

Ingredient ID: NPC282268

Ingredient ID: NPC280760

Ingredient ID: NPC259512

Ingredient ID: NPC225105

Ingredient ID: NPC169957

Ingredient ID: NPC137865

Ingredient ID: NPC109813