• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Citrus Limon


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGTAGAACGACCAGCGAACCAGTCGATATCACTGACGGCAGGAAGGGGGATGCATCCGTAGCGGGCGATCCTCCTTCCTGCCCCACGCCGTGGGGAGAGGGGCTCGTCCCGCTCCCGACTGGCGAAACAACGAACACCCGGCGTAGACTGCGCCAAGGAAATCTAACAAGAGAGCACGCTCCCACGGCCCCGGAGACAGTGCGCAGCGCCTTCTTTCAAATGTATCCAAAATGACTCTCGGCAACGGATATCTCAGGTCTCGTATCGATGAAGAACATAGCAAAATACGATACTTGGTGTGAATTGCAGAATCCCATGAACTATCGAGTCTTTGAACGCAAGTTGTGCCCCAAGCCATTAGGCCGAGGGCATGTCTGCCTGTGTGTCATGCATCGTTGCCCCACCCCACCCACGCAAACCAAGGCGGGGGCCCCGGGGTGCGGGCATAGATTGGCCTCCCGTACGCTGACTGCTCGCGGTTGGCCCAAATATGAGTCCTCGGCGACTGAAGTCGCGGCGATCGGTGGTGAAACAAAGCCTCTCAAGCTCCCGCTGCGCGCCCGATCTCCAAGTGTGGACTCTACGACCCTGAAGCTCCACGCAAGCGGCAAAGATCATTACTGAACATGTGATAACCCGTCAAGGTTCTGGAAGGG

Click for details-----ITS1

GTAGGTGAACCTGCGGAAGGATCATTGTCGAWACCTGCCTAGCAGAACGACCCGCGAACTTGTATTCAAAATCGGGCGGCACGGGCGCAGCGCTTCGGCACTCGCCCGTCGCCCCCTCGTCGGGAGTGCACGCACTGCCTCGGCAATGCCTGCGCTTCCCGACACCTAAACGAACCCCGGCGCGGTATGCGCCAAGGAAATGTAACAAAGACAGCCTGCCCGGAAGCCCCGTCCGCGGGTGCCGAAGGGCAATGCCGTCTTACACAAAAACTAAA

Click for details-----ITS2

ATCGTTGCCCCACCCCACCCACGCAAACCAAGGCGGGGGCCCCGGGGTGCGGGCATAGATTGGCCTCCCGTACGCTGACTGCTCGCGGTTGGCCCAAATATGAGTCCTCGGCGACTGAAGTCGCGGCGATCGGTGGTGAAACAAAGCCTCTCAAGCTCCCGCTGCGCGCCCGATCTCCAAGTGTGGACTCTACGACCCTGAAGCTCCACGCAAGCGGCAAAGATCATTACTGAACATGTGATAACCCGTCAAGGTTCTGGAAGGG
Taxonomic Information

Plant ID: NPO319
Plant Latin Name: Citrus Limon
Taxonomy Genus: Citrus
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 2708
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Guinea; China; India

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Antibacterial; Antiperiodic; Antiscorbutic; Aromatherapy; Astringent; Carminative; Miscellany; Refrigerant; Rubefacient; Stimulant; Stomachic; Vitamin C

Geographical Distribution

Guinea; China; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

208 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


153 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

121 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92828

Ingredient ID: NPC88566

Ingredient ID: NPC86545

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC84479

Ingredient ID: NPC83604

Ingredient ID: NPC81010

Ingredient ID: NPC79943

Ingredient ID: NPC79056

Ingredient ID: NPC76145

Ingredient ID: NPC73494

Ingredient ID: NPC70744

Ingredient ID: NPC68889

Ingredient ID: NPC67508

Ingredient ID: NPC64176

Ingredient ID: NPC62045

Ingredient ID: NPC60288

Ingredient ID: NPC60151

Ingredient ID: NPC55412

Ingredient ID: NPC54158

Ingredient ID: NPC49151

Ingredient ID: NPC491290

Ingredient ID: NPC491218

Ingredient ID: NPC490449

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490233

Ingredient ID: NPC490162

Ingredient ID: NPC490059

Ingredient ID: NPC489907

Ingredient ID: NPC47946

Ingredient ID: NPC43587

Ingredient ID: NPC42923

Ingredient ID: NPC424

Ingredient ID: NPC3780

Ingredient ID: NPC3649

Ingredient ID: NPC35983

Ingredient ID: NPC34764

Ingredient ID: NPC329394

Ingredient ID: NPC328447

Ingredient ID: NPC32441

Ingredient ID: NPC323956

Ingredient ID: NPC323349

Ingredient ID: NPC32279

Ingredient ID: NPC318126

Ingredient ID: NPC317120

Ingredient ID: NPC315224

Ingredient ID: NPC313955

Ingredient ID: NPC313179

Ingredient ID: NPC306296

Ingredient ID: NPC302950

Ingredient ID: NPC302556

Ingredient ID: NPC300326

Ingredient ID: NPC298796

Ingredient ID: NPC298724

Ingredient ID: NPC29835

Ingredient ID: NPC297643

Ingredient ID: NPC296256

Ingredient ID: NPC295154

Ingredient ID: NPC294902

Ingredient ID: NPC294852

Ingredient ID: NPC294548

Ingredient ID: NPC293852

Ingredient ID: NPC292792

Ingredient ID: NPC291124

Ingredient ID: NPC290319

Ingredient ID: NPC289388

Ingredient ID: NPC288714

Ingredient ID: NPC287331

Ingredient ID: NPC287216

Ingredient ID: NPC284617

Ingredient ID: NPC281686

Ingredient ID: NPC281457

Ingredient ID: NPC279865

Ingredient ID: NPC279508

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC27765

Ingredient ID: NPC276009

Ingredient ID: NPC273832

Ingredient ID: NPC272614

Ingredient ID: NPC271270

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269193

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC26600

Ingredient ID: NPC2660

Ingredient ID: NPC265305

Ingredient ID: NPC264537

Ingredient ID: NPC262505

Ingredient ID: NPC261228

Ingredient ID: NPC257188

Ingredient ID: NPC256849

Ingredient ID: NPC256848

Ingredient ID: NPC252603

Ingredient ID: NPC251102

Ingredient ID: NPC249048

Ingredient ID: NPC248955

Ingredient ID: NPC246679

Ingredient ID: NPC246165

Ingredient ID: NPC242895

Ingredient ID: NPC242580

Ingredient ID: NPC239270

Ingredient ID: NPC237812

Ingredient ID: NPC231738

Ingredient ID: NPC231662

Ingredient ID: NPC230573

Ingredient ID: NPC230301

Ingredient ID: NPC229262

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC22098

Ingredient ID: NPC220596

Ingredient ID: NPC219143

Ingredient ID: NPC216092

Ingredient ID: NPC216083

Ingredient ID: NPC215894

Ingredient ID: NPC215632

Ingredient ID: NPC215012

Ingredient ID: NPC214327

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC210316

Ingredient ID: NPC209296

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC199072

Ingredient ID: NPC197122

Ingredient ID: NPC19546

Ingredient ID: NPC19545

Ingredient ID: NPC190810

Ingredient ID: NPC190771

Ingredient ID: NPC19074

Ingredient ID: NPC190270

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC185541

Ingredient ID: NPC183815

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC178638

Ingredient ID: NPC17810

Ingredient ID: NPC177771

Ingredient ID: NPC177112

Ingredient ID: NPC176740

Ingredient ID: NPC175987

Ingredient ID: NPC175575

Ingredient ID: NPC174477

Ingredient ID: NPC174246

Ingredient ID: NPC173833

Ingredient ID: NPC173208

Ingredient ID: NPC17312

Ingredient ID: NPC169749

Ingredient ID: NPC16956

Ingredient ID: NPC167400

Ingredient ID: NPC166362

Ingredient ID: NPC165651

Ingredient ID: NPC163556

Ingredient ID: NPC15912

Ingredient ID: NPC158956

Ingredient ID: NPC15573

Ingredient ID: NPC154792

Ingredient ID: NPC154186

Ingredient ID: NPC152451

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC149244

Ingredient ID: NPC147983

Ingredient ID: NPC145373

Ingredient ID: NPC144023

Ingredient ID: NPC141777

Ingredient ID: NPC141078

Ingredient ID: NPC138583

Ingredient ID: NPC138572

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC137949

Ingredient ID: NPC136281

Ingredient ID: NPC136014

Ingredient ID: NPC135353

Ingredient ID: NPC13496

Ingredient ID: NPC13402

Ingredient ID: NPC133360

Ingredient ID: NPC130760

Ingredient ID: NPC130683

Ingredient ID: NPC129170

Ingredient ID: NPC128428

Ingredient ID: NPC126681

Ingredient ID: NPC121967

Ingredient ID: NPC119090

Ingredient ID: NPC116775

Ingredient ID: NPC11609

Ingredient ID: NPC115674

Ingredient ID: NPC11433

Ingredient ID: NPC114266

Ingredient ID: NPC112890

Ingredient ID: NPC112701

Ingredient ID: NPC1075

Ingredient ID: NPC105095