• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ampelopsis Brevipedunculata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGTCGACCTCTGCGTAGCAGAACGACCCGCGAACATGTTGCAACTCCTCGGGGGCGGAGCAGGGCGCGAGCCCACCGCTCCGCCTCCCGATTGAGAGGCCTCGGGAGCCCTGCCTGTCGTCGTGCCTTGTGCATGGGCCCGGCGGGTGCTCTCGATGGCTCCTCTCAAACAAACAACGAACCCCGGCGCGGAAAGCGCCAAGGAACTTGAACGGAGCAACGCTCTCCCCATGCCCCGATCCCGGGTGCCTGGGCGAGATGTCGTCGTTTTCATAAATATTATATAGAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCATGCCTGCCTGGGCGTCACCCACCCGTCGCCCCCCTCCCCCCCAAAGCCGTGCGCTGGGGGATGCGGAGCGGGGGCGGACATTGGCCTCCCGTGGACGCCCTATGTCCGCGGTTGGCCGAAAATCGGTCCCGCGGCGGCGTACGCCACGACAAGCGGTGGTCTAACAACCCCCTCCCCCCATCGAGGAGGAGAAGCCCGGAGTCGTGCGCGCGGCGTCGCCTCGGTGGCCCCCTGATTGAAAGGCCCGACACCCTCGATAGTGA

Click for details-----ITS1

NA

Click for details-----ITS2

ACCCGTCGCCCCCCTCCCCCCCAAAGCCGTGCGCTGGGGGATGCGGAGCGGGGGCGGACATTGGCCTCCCGTGGACGCCCTATGTCCGCGGTTGGCCGAAAATCGGTCCCGCGGCGGCGTACGCCACGACAAGCGGTGGTCTAACAACCCCCTCCCCCCATCGAGGAGGAGAAGCCCGGAGTCGTGCGCGCGGCGTCGCCTCGGTGGCCCCCTGATTGAAAGGCCCGACACCCTCGATAGTGA
Taxonomic Information

Plant ID: NPO31111
Plant Latin Name: Ampelopsis Brevipedunculata
Taxonomy Genus: Ampelopsis
Taxonomy Family: Vitaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antiphlogistic; Depurative; Febrifuge

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC836

Ingredient ID: NPC62290

Ingredient ID: NPC290598

Ingredient ID: NPC283496

Ingredient ID: NPC248573

Ingredient ID: NPC161571

Ingredient ID: NPC157333

Ingredient ID: NPC1321

Ingredient ID: NPC116775

Ingredient ID: NPC104616