• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Bupleurum Falcatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GCGGAAGGATCATTGTCGAGTCCCGAATCACGAAGCGACCCGAGAACATGTTTTATGACAGGGCCAGTGGTCGCCGGTCTTGGCCTGGCGATTGCGAACCCTCGGTCGGGGGGCGCCTAGTTGCGCTCGCCGGCCCAAATTTTAACCGGGCGCGGAATGCGCCAAGGAAATTACAACCGAATAGGATGTGTCCTCCCCGTTTGAGGGGCGGCGACATCCTTTTGAGAAACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACGTAAAGATTTGCCCCTCCTCTGCTCGCTCATTTTGAGTTGTTGCAGTTTGAGGGGGCGGAAAGTGACCTCCCGTGCCTTGTTGCGCGGCTGGTTTAAAAGATAGTCTCCGGAGACCGGAAAAACGCAACATTGGTGGAAGGCATTACTAACCTCTTGCCATCTTGCGCCGAGTCCGTTTACTCTGTGAGCTATAGCGACCCTTTGGCGCCGCCCTAGGCGTGCGCTCAAACTGTGACCCCAGGT

Click for details-----ITS1

GCGGAAGGATCATTGTCGAGTCCCGAATCACGAAGCGACCCGAGAACATGTTTTATGACAGGGCCAGTGGTCGCCGGTCTTGGCCTGGCGATTGCGAACCCTCGGTCGGGGGGCGCCTAGTTGCGCTCGCCGGCCCAAATTTTAACCGGGCGCGGAATGCGCCAAGGAAATTACAACCGAATAGGATGTGTCCTCCCCGTTTGAGGGGCGGCGACATCCTTTTGAGAAACAAA

Click for details-----ITS2

ATAGCTTTGCCCCTCCGCAGCTCGCTCAAAGCGAGTCATTGCTGTTCGGGGGGACGGAAAGTGACCTCCCGTGCCTCGTCGTGCGGCTGGTTTAAAAGAGAGTCTCCGGAGATCGGAAAACGCAACATTGGTGGAAGGCATTACGCACCTCTTGCCATCTTGCGCTGAGCCCGTTTACTCCGTGAGCAACAGCGACCCTTTGGCGCCGCCCCAGGTGCGCGCTCGAACTGTGACCCCAGTCAGTCGACTAGCCAAAGCC
Taxonomic Information

Plant ID: NPO3107
Plant Latin Name: Bupleurum Falcatum
Taxonomy Genus: Bupleurum
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 46367
Plant-of-the-World-Online: 839147-1

Used in Medicines

Country/Region:
China; South Korea; India

Traditional Medicine System:
Indian Folk; TCM; Kampo

Geographical Distribution

Ukraine; Romania; Albania; Italy; Poland; India; France; United Kingdom; Switzerland; Austria; China; Hungary; Belgium; Germany; South Korea; Russia; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

254 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


144 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

111 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98098

Ingredient ID: NPC97816

Ingredient ID: NPC93888

Ingredient ID: NPC93617

Ingredient ID: NPC93074

Ingredient ID: NPC92592

Ingredient ID: NPC91574

Ingredient ID: NPC89422

Ingredient ID: NPC86682

Ingredient ID: NPC86191

Ingredient ID: NPC8614

Ingredient ID: NPC85813

Ingredient ID: NPC84462

Ingredient ID: NPC82538

Ingredient ID: NPC81853

Ingredient ID: NPC81500

Ingredient ID: NPC78860

Ingredient ID: NPC78551

Ingredient ID: NPC76976

Ingredient ID: NPC76497

Ingredient ID: NPC76455

Ingredient ID: NPC76145

Ingredient ID: NPC75584

Ingredient ID: NPC7491

Ingredient ID: NPC74901

Ingredient ID: NPC72722

Ingredient ID: NPC7208

Ingredient ID: NPC72024

Ingredient ID: NPC71703

Ingredient ID: NPC67920

Ingredient ID: NPC67761

Ingredient ID: NPC6754

Ingredient ID: NPC6717

Ingredient ID: NPC67118

Ingredient ID: NPC66577

Ingredient ID: NPC65880

Ingredient ID: NPC62476

Ingredient ID: NPC61769

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC59408

Ingredient ID: NPC58629

Ingredient ID: NPC58478

Ingredient ID: NPC57065

Ingredient ID: NPC56112

Ingredient ID: NPC54521

Ingredient ID: NPC52230

Ingredient ID: NPC51758

Ingredient ID: NPC4891

Ingredient ID: NPC47944

Ingredient ID: NPC47417

Ingredient ID: NPC44298

Ingredient ID: NPC43728

Ingredient ID: NPC43246

Ingredient ID: NPC42813

Ingredient ID: NPC42471

Ingredient ID: NPC424

Ingredient ID: NPC39122

Ingredient ID: NPC36061

Ingredient ID: NPC35519

Ingredient ID: NPC34908

Ingredient ID: NPC34764

Ingredient ID: NPC34589

Ingredient ID: NPC33761

Ingredient ID: NPC33666

Ingredient ID: NPC3357

Ingredient ID: NPC33489

Ingredient ID: NPC32279

Ingredient ID: NPC321195

Ingredient ID: NPC306232

Ingredient ID: NPC305327

Ingredient ID: NPC304885

Ingredient ID: NPC30416

Ingredient ID: NPC301771

Ingredient ID: NPC301696

Ingredient ID: NPC300833

Ingredient ID: NPC298328

Ingredient ID: NPC297822

Ingredient ID: NPC297796

Ingredient ID: NPC296651

Ingredient ID: NPC295217

Ingredient ID: NPC293378

Ingredient ID: NPC292092

Ingredient ID: NPC290608

Ingredient ID: NPC290078

Ingredient ID: NPC287731

Ingredient ID: NPC287584

Ingredient ID: NPC287435

Ingredient ID: NPC286233

Ingredient ID: NPC285322

Ingredient ID: NPC285253

Ingredient ID: NPC283692

Ingredient ID: NPC282076

Ingredient ID: NPC282024

Ingredient ID: NPC280141

Ingredient ID: NPC279300

Ingredient ID: NPC278189

Ingredient ID: NPC277907

Ingredient ID: NPC272614

Ingredient ID: NPC271087

Ingredient ID: NPC270141

Ingredient ID: NPC264735

Ingredient ID: NPC264375

Ingredient ID: NPC261831

Ingredient ID: NPC261501

Ingredient ID: NPC260850

Ingredient ID: NPC259878

Ingredient ID: NPC256154

Ingredient ID: NPC253747

Ingredient ID: NPC253263

Ingredient ID: NPC251860

Ingredient ID: NPC249009

Ingredient ID: NPC246543

Ingredient ID: NPC246534

Ingredient ID: NPC245787

Ingredient ID: NPC24511

Ingredient ID: NPC243433

Ingredient ID: NPC24327

Ingredient ID: NPC24294

Ingredient ID: NPC241721

Ingredient ID: NPC241171

Ingredient ID: NPC237795

Ingredient ID: NPC237435

Ingredient ID: NPC236709

Ingredient ID: NPC234820

Ingredient ID: NPC233209

Ingredient ID: NPC23129

Ingredient ID: NPC227360

Ingredient ID: NPC226692

Ingredient ID: NPC226520

Ingredient ID: NPC226453

Ingredient ID: NPC224651

Ingredient ID: NPC223848

Ingredient ID: NPC223312

Ingredient ID: NPC221110

Ingredient ID: NPC219607

Ingredient ID: NPC219485

Ingredient ID: NPC218267

Ingredient ID: NPC217226

Ingredient ID: NPC216630

Ingredient ID: NPC213935

Ingredient ID: NPC21290

Ingredient ID: NPC212223

Ingredient ID: NPC21209

Ingredient ID: NPC209970

Ingredient ID: NPC209753

Ingredient ID: NPC209279

Ingredient ID: NPC208936

Ingredient ID: NPC208793

Ingredient ID: NPC208708

Ingredient ID: NPC208075

Ingredient ID: NPC205432

Ingredient ID: NPC203354

Ingredient ID: NPC202691

Ingredient ID: NPC202189

Ingredient ID: NPC200678

Ingredient ID: NPC200459

Ingredient ID: NPC200321

Ingredient ID: NPC200137

Ingredient ID: NPC197376

Ingredient ID: NPC197087

Ingredient ID: NPC196676

Ingredient ID: NPC195697

Ingredient ID: NPC195116

Ingredient ID: NPC194998

Ingredient ID: NPC194586

Ingredient ID: NPC19392

Ingredient ID: NPC19300

Ingredient ID: NPC192402

Ingredient ID: NPC190810

Ingredient ID: NPC19044

Ingredient ID: NPC190184

Ingredient ID: NPC18938

Ingredient ID: NPC188169

Ingredient ID: NPC187058

Ingredient ID: NPC185019

Ingredient ID: NPC184049

Ingredient ID: NPC183840

Ingredient ID: NPC18335

Ingredient ID: NPC18333

Ingredient ID: NPC18188

Ingredient ID: NPC180459

Ingredient ID: NPC179831

Ingredient ID: NPC178952

Ingredient ID: NPC178726

Ingredient ID: NPC176066

Ingredient ID: NPC176017

Ingredient ID: NPC175342

Ingredient ID: NPC174167

Ingredient ID: NPC168316

Ingredient ID: NPC16728

Ingredient ID: NPC166954

Ingredient ID: NPC166303

Ingredient ID: NPC165792

Ingredient ID: NPC1656

Ingredient ID: NPC162558

Ingredient ID: NPC162354

Ingredient ID: NPC162282

Ingredient ID: NPC16157

Ingredient ID: NPC159900

Ingredient ID: NPC159177

Ingredient ID: NPC158663

Ingredient ID: NPC158020

Ingredient ID: NPC157781

Ingredient ID: NPC157340

Ingredient ID: NPC155674

Ingredient ID: NPC15564

Ingredient ID: NPC154186

Ingredient ID: NPC152440

Ingredient ID: NPC148392

Ingredient ID: NPC147337

Ingredient ID: NPC146244

Ingredient ID: NPC146197

Ingredient ID: NPC142265

Ingredient ID: NPC140099

Ingredient ID: NPC13991

Ingredient ID: NPC139545

Ingredient ID: NPC139029

Ingredient ID: NPC13789

Ingredient ID: NPC137847

Ingredient ID: NPC137720

Ingredient ID: NPC136014

Ingredient ID: NPC133340

Ingredient ID: NPC130683

Ingredient ID: NPC128987

Ingredient ID: NPC128882

Ingredient ID: NPC127387

Ingredient ID: NPC127026

Ingredient ID: NPC126702

Ingredient ID: NPC126681

Ingredient ID: NPC123229

Ingredient ID: NPC116997

Ingredient ID: NPC116709

Ingredient ID: NPC116295

Ingredient ID: NPC115067

Ingredient ID: NPC114239

Ingredient ID: NPC112941

Ingredient ID: NPC110656

Ingredient ID: NPC110494

Ingredient ID: NPC109792

Ingredient ID: NPC108494

Ingredient ID: NPC108358

Ingredient ID: NPC107373

Ingredient ID: NPC106958

Ingredient ID: NPC106250

Ingredient ID: NPC105557

Ingredient ID: NPC105509

Ingredient ID: NPC105246

Ingredient ID: NPC104729

Ingredient ID: NPC103851

Ingredient ID: NPC103553

Ingredient ID: NPC101285

Ingredient ID: NPC101278

Ingredient ID: NPC101218