• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Citrus Hystrix


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGATCATGTCGAAACCTGCCCAGCAGAACGACCCGCGAAACCAGTTGATATCACCGGCGGCGGGAGGGGGGATGCGTCCGCAGCGGGCGCTCYTCCTTYTCGCCCCACGCCGCGGGGAGAGGGACTCGTCCCGCTCCCGGCTGGCGAAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGCGGCCCCGGAGACGGTGCGCCGCGGGGTGCGGCGCCTTCTTTCACATGCATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCACCCCACCCCCCCAAAACCAAGGSGGGGGCCCCGGGGTGCGGGCGGAGATTGGCCTCCCGTGCGCTGACCGCTCGCGGTTGGCCCAAATATGAGTCCTCGGCGACCGAAGCCGCGGCGATCGGTGGKGAAACAAAGCCTYTCSAGCTYCCGCCGCGCGCCCGGTCTCCAAGTGTGGACTCTGCGACCCTGAAGCTCCGCGCAAGCGGCGCTCGCATTGGCACCCCAGGTCAGGGGGGATTACCCGCTTA

Click for details-----ITS1

GGATCATGTCGAAACCTGCCCAGCAGAACGACCCGCGAAACCAGTTGATATCACCGGCGGCGGGAGGGGGGATGCGTCCGCAGCGGGCGCTCYTCCTTYTCGCCCCACGCCGCGGGGAGAGGGACTCGTCCCGCTCCCGGCTGGCGAAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGCGGCCCCGGAGACGGTGCGCCGCGGGGTGCGGCGCCTTCTTTCACATGCATCCAAAA

Click for details-----ITS2

ATCGTTGCCCCACCCCACCCCCCCAAAACCAAGGSGGGGGCCCCGGGGTGCGGGCGGAGATTGGCCTCCCGTGCGCTGACCGCTCGCGGTTGGCCCAAATATGAGTCCTCGGCGACCGAAGCCGCGGCGATCGGTGGKGAAACAAAGCCTYTCSAGCTYCCGCCGCGCGCCCGGTCTCCAAGTGTGGACTCTGCGACCCTGAAGCTCCGCGCAAGCGGCGCTCGCATTGGCACCCCAGGTCAGGGGGGATTACCCGCTTA
Taxonomic Information

Plant ID: NPO30686
Plant Latin Name: Citrus Hystrix
Taxonomy Genus: Citrus
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: 771927-1

Used in Medicines

Country/Region:
Thailand; Indonesia; India

Traditional Medicine System:
Indian Folk

Geographical Distribution

Australia; Bangladesh; Myanmar; Philippines; Indonesia; India; New Caledonia; Cambodia; Trinidad and Tobago; Vietnam; China; Papua New Guinea; Sri Lanka; Thailand; Fiji

Geographical Distribution
+
−
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

18 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC88445

Ingredient ID: NPC67508

Ingredient ID: NPC325351

Ingredient ID: NPC325176

Ingredient ID: NPC321359

Ingredient ID: NPC289388

Ingredient ID: NPC285267

Ingredient ID: NPC276009

Ingredient ID: NPC266718

Ingredient ID: NPC250769

Ingredient ID: NPC24824

Ingredient ID: NPC243738

Ingredient ID: NPC243728

Ingredient ID: NPC239270

Ingredient ID: NPC23134

Ingredient ID: NPC230301

Ingredient ID: NPC191104

Ingredient ID: NPC14822

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target TypeProtein ClassGene IDProtein NameUniprot IDTarget ChEMBL ID
Cytochrome P450 Cytochrome P450 family 2 CYP2C19 Cytochrome P450 2C19 P33261 CHEMBL3622
Cytochrome P450 Cytochrome P450 family 2 CYP2D6 Cytochrome P450 2D6 P10635 CHEMBL289
Cytochrome P450 Cytochrome P450 family 2 CYP2C9 Cytochrome P450 2C9 P11712 CHEMBL3397
Showing 1 to 3 of 3 entries
Previous1Next
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
Clinical trial details
NCT IDTitleConditionForm in clinical useAssociated by plant or compound
No data available in table
Showing 0 to 0 of 0 entries
PreviousNext

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CYP2C9,F2,CYP2D6
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CYP2C19,CYP2C9,F2
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 F2
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 BACE1
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 F2
Anxiety
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB24.3
 CYP3A4
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 F2
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 CYP3A4
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CYP2C9
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F2
Showing 1 to 10 of 38 entries
Previous1234Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group