• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Polygonum Aviculare


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCGAGAGCAGAAGGACCCGCGAACACGTTGTTAAACAAAAAGCCCGGGCCCCCAACAAAGGCCCGGCACCAACCAAACCCCGGCGCGGATTGCGCCAAGGACCATGAACATGCGCAGCGCGCCCTGCCCCGCCGGGCCTCCGGCGGACGCGGCGGCGTCGTGTCGTTTCTACCGTCCAAAACAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGGCAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTACTTGCGCCCGAAGCCCTCGTGGCCAGGGCACGTCTGTCTGGGCGTCACGCACCGCGTCGCCTCCCCACCCCCCTCCGGGGGGGACGGGGCGGAGACTGGCCCCCCGTGTGCCNCCAGGGCGCGCGCGGCCGGCCCAAACGCAGACCCCGCGGCCGCTGGACGGCGCGACGATCGGTGGAGTAGACCCCTACGCATCCCGTCGCGCCCCGAGCGGCCCTCGGAGGCCACGATCGACCCTCATTGAAACCCACCGTT

Click for details-----ITS1

TCGAAACCTGCGAGAGCAGAAGGACCCGCGAACACGTTGTTAAACAAAAAGCCCGGGCCCCCAACAAAGGCCCGGCACCAACCAAACCCCGGCGCGGATTGCGCCAAGGACCATGAACATGCGCAGCGCGCCCTGCCCCGCCGGGCCTCCGGCGGACGCGGCGGCGTCGTGTCGTTTCTACCGTCCAAAACAGAA

Click for details-----ITS2

ACCGCGTCGCCTCCCCACCCCCCTCCGGGGGGGACGGGGCGGAGACTGGCCCCCCGTGTGCCNCCAGGGCGCGCGCGGCCGGCCCAAACGCAGACCCCGCGGCCGCTGGACGGCGCGACGATCGGTGGAGTAGACCCCTACGCATCCCGTCGCGCCCCGAGCGGCCCTCGGAGGCCACGATCGACCCTCATTGAAACCCACCGTT
Taxonomic Information

Plant ID: NPO3057
Plant Latin Name: Polygonum Aviculare
Taxonomy Genus: Polygonum
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 137693
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
India; Israel; Albania; Italy; Lithuania; Lebanon; Sweden; China; Chile; Argentina; Russia; Spain; Bulgaria

Traditional Medicine System:
TCM; Unani; Ayurveda


Medicinal Functions:

Anthelmintic; Antiphlogistic; Astringent; Cardiotonic; Cholagogue; Diuretic; Emetic; Emollient; Expectorant; Febrifuge; Haemostatic; Lithontripic; Purgative; TB; Vasoconstrictor; Vulnerary

Geographical Distribution

Israel; Albania; Italy; Lebanon; India; Sweden; China; Spain; Chile; Argentina; Russia; Lithuania; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

53 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

34 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC84811

Ingredient ID: NPC80341

Ingredient ID: NPC77642

Ingredient ID: NPC76336

Ingredient ID: NPC73855

Ingredient ID: NPC67037

Ingredient ID: NPC65966

Ingredient ID: NPC61506

Ingredient ID: NPC36835

Ingredient ID: NPC34531

Ingredient ID: NPC328940

Ingredient ID: NPC321320

Ingredient ID: NPC318470

Ingredient ID: NPC306478

Ingredient ID: NPC302857

Ingredient ID: NPC294902

Ingredient ID: NPC290613

Ingredient ID: NPC290294

Ingredient ID: NPC288084

Ingredient ID: NPC286342

Ingredient ID: NPC286245

Ingredient ID: NPC281131

Ingredient ID: NPC281128

Ingredient ID: NPC279121

Ingredient ID: NPC260491

Ingredient ID: NPC255615

Ingredient ID: NPC252928

Ingredient ID: NPC246162

Ingredient ID: NPC240476

Ingredient ID: NPC235260

Ingredient ID: NPC233443

Ingredient ID: NPC225710

Ingredient ID: NPC217387

Ingredient ID: NPC20791

Ingredient ID: NPC205003

Ingredient ID: NPC179950

Ingredient ID: NPC173638

Ingredient ID: NPC173637

Ingredient ID: NPC169749

Ingredient ID: NPC155763

Ingredient ID: NPC154792

Ingredient ID: NPC154172

Ingredient ID: NPC152324

Ingredient ID: NPC142703

Ingredient ID: NPC142415

Ingredient ID: NPC138927

Ingredient ID: NPC133671

Ingredient ID: NPC130577

Ingredient ID: NPC125062

Ingredient ID: NPC1222

Ingredient ID: NPC116775

Ingredient ID: NPC11666

Ingredient ID: NPC1075