• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Croton Tiglium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CGTAGGTGACCTGCGGAGGATCATTGTCGAAACCTGCATAGCAGAACGACTCGTGAACAAGTAAGACAACACTAGGGTGACCTCTGGGGCCTCCGGGCGCCATTGCGAACCTAATGGCTAAGCCGTGTCATGTCAGGCTAGGCTTCGGCCTGTTTCACATGCACTGCTAAGTCTAACAACCAACCCCGGCGCAAGACGCGCCAAGGAAAACATAAAATAAAAGAGAAGACGCGTCTGACCGGTCCCGGCCTCGGGATCCCGGAAAGAATGCCGTCCTCCTTTTTTAAAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTTCGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAGCATCGCTCCCAACCCATTGGGGTGCGGAATATGGCCTCCCGTGCGATTCTCTCCCGCGGTTGGCCTAAAAGAATGGTCCTCGGCTGCAAATGCCGCGACAATCGGTGGTTGCAAGGCCCTCGGACACAGTCGCGCGCGCACGTATGCCTTTGGATAACGAGACCCCTCTGCGTCCGCGTCCTTCGCGGCACGCTCACA

Click for details-----ITS1

CGTAGGTGACCTGCGGAGGATCATTGTCGAAACCTGCATAGCAGAACGACTCGTGAACAAGTAAGACAACACTAGGGTGACCTCTGGGGCCTCCGGGCGCCATTGCGAACCTAATGGCTAAGCCGTGTCATGTCAGGCTAGGCTTCGGCCTGTTTCACATGCACTGCTAAGTCTAACAACCAACCCCGGCGCAAGACGCGCCAAGGAAAACATAAAATAAAAGAGAAGACGCGTCTGACCGGTCCCGGCCTCGGGATCCCGGAAAGAATGCCGTCCTCCTTTTTTAAAAAAA

Click for details-----ITS2

AGCATCGCTCCCAACCCATTGGGGTGCGGAATATGGCCTCCCGTGCGATTCTCTCCCGCGGTTGGCCTAAAAGAATGGTCCTCGGCTGCAAATGCCGCGACAATCGGTGGTTGCAAGGCCCTCGGACACAGTCGCGCGCGCACGTATGCCTTTGGATAACGAGACCCCTCTGCGTCCGCGTCCTTCGCGGCACGCTCACATC
Taxonomic Information

Plant ID: NPO2978
Plant Latin Name: Croton Tiglium
Taxonomy Genus: Croton
Taxonomy Family: Euphorbiaceae

Plant External Links:

NCBI TaxonomyDB: 497687
Plant-of-the-World-Online: 343631-1

Used in Medicines

Country/Region:
Indonesia; India; Jordan; Thailand; China; South Korea

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; Kampo; TCM; Homeopathy

Geographical Distribution

Maldives; Bangladesh; Myanmar; Philippines; Indonesia; India; Cambodia; Jordan; Vietnam; China; Thailand; Sri Lanka; Japan; South Korea; Nepal; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

121 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


60 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

53 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC93755

Ingredient ID: NPC89778

Ingredient ID: NPC89069

Ingredient ID: NPC85813

Ingredient ID: NPC80939

Ingredient ID: NPC77272

Ingredient ID: NPC74543

Ingredient ID: NPC64022

Ingredient ID: NPC63141

Ingredient ID: NPC5991

Ingredient ID: NPC5989

Ingredient ID: NPC48853

Ingredient ID: NPC472401

Ingredient ID: NPC472400

Ingredient ID: NPC472399

Ingredient ID: NPC472398

Ingredient ID: NPC472397

Ingredient ID: NPC471128

Ingredient ID: NPC471127

Ingredient ID: NPC471126

Ingredient ID: NPC471125

Ingredient ID: NPC424

Ingredient ID: NPC37663

Ingredient ID: NPC36780

Ingredient ID: NPC35565

Ingredient ID: NPC32762

Ingredient ID: NPC327118

Ingredient ID: NPC323941

Ingredient ID: NPC323434

Ingredient ID: NPC319387

Ingredient ID: NPC319380

Ingredient ID: NPC317100

Ingredient ID: NPC312187

Ingredient ID: NPC309182

Ingredient ID: NPC308218

Ingredient ID: NPC30486

Ingredient ID: NPC302857

Ingredient ID: NPC300956

Ingredient ID: NPC29976

Ingredient ID: NPC298573

Ingredient ID: NPC298062

Ingredient ID: NPC297722

Ingredient ID: NPC297398

Ingredient ID: NPC297363

Ingredient ID: NPC294687

Ingredient ID: NPC294548

Ingredient ID: NPC290371

Ingredient ID: NPC283655

Ingredient ID: NPC280225

Ingredient ID: NPC277917

Ingredient ID: NPC277130

Ingredient ID: NPC275696

Ingredient ID: NPC273973

Ingredient ID: NPC266144

Ingredient ID: NPC261831

Ingredient ID: NPC260084

Ingredient ID: NPC259184

Ingredient ID: NPC257600

Ingredient ID: NPC257017

Ingredient ID: NPC255081

Ingredient ID: NPC253820

Ingredient ID: NPC252441

Ingredient ID: NPC250042

Ingredient ID: NPC249045

Ingredient ID: NPC244653

Ingredient ID: NPC24361

Ingredient ID: NPC242992

Ingredient ID: NPC234858

Ingredient ID: NPC22628

Ingredient ID: NPC225851

Ingredient ID: NPC219400

Ingredient ID: NPC218994

Ingredient ID: NPC21841

Ingredient ID: NPC217809

Ingredient ID: NPC216630

Ingredient ID: NPC213262

Ingredient ID: NPC209970

Ingredient ID: NPC208855

Ingredient ID: NPC208620

Ingredient ID: NPC201844

Ingredient ID: NPC196500

Ingredient ID: NPC196490

Ingredient ID: NPC187854

Ingredient ID: NPC186904

Ingredient ID: NPC186902

Ingredient ID: NPC186653

Ingredient ID: NPC181153

Ingredient ID: NPC179465

Ingredient ID: NPC176360

Ingredient ID: NPC171905

Ingredient ID: NPC166553

Ingredient ID: NPC166112

Ingredient ID: NPC164700

Ingredient ID: NPC164665

Ingredient ID: NPC162009

Ingredient ID: NPC158404

Ingredient ID: NPC157378

Ingredient ID: NPC157252

Ingredient ID: NPC157248

Ingredient ID: NPC154932

Ingredient ID: NPC154363

Ingredient ID: NPC153875

Ingredient ID: NPC152989

Ingredient ID: NPC152618

Ingredient ID: NPC150713

Ingredient ID: NPC149494

Ingredient ID: NPC146280

Ingredient ID: NPC146197

Ingredient ID: NPC145182

Ingredient ID: NPC144561

Ingredient ID: NPC140021

Ingredient ID: NPC138591

Ingredient ID: NPC137599

Ingredient ID: NPC135353

Ingredient ID: NPC127197

Ingredient ID: NPC124800

Ingredient ID: NPC124676

Ingredient ID: NPC123304

Ingredient ID: NPC119949

Ingredient ID: NPC10721

Ingredient ID: NPC100362