• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Vigna Angularis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ACTGCGGAGGATCATTGTCGATGCCTAAACCAATCCGACCAGCGAACGCGTCCAAACACCCGAAGCGTCGGGAGAGGGGCGGTCGCAACGGACCTCACCTCTCCAGGCAAAACCCAAACCCCGGCACCATACGTGCCAAGGATCCGAAACACATTCTTGGTCGACTCCGAAGGACGGTGTCCGACGGAATCGGCACGAAACGAATCGAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTCATCCCCATGCAAACGCGCATCGGGGCGAAAGCTGGCCTCCCGCGAGACAACCATCGTGGTTGGTCGAAAACCAAGGTAATGTCGGGGTCCCCCCGCGAGAAACGGTGGATGAGCAAACGCTCGAGACCAATCGTGGAGACTTGGCAATCCAATTGATCGGCCCTATTGCGTTCTTGGCAGAAAGCAAAGACGCTCTTA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTCATCCCCATGCAAACACGCATCGGGGCGAAAGCTGGCCTCCCGCGAGACAACCATCGTGGTTGGTCGAAAACCAAGGTAATGTCGGGGTCCCCCCGCGAGAAACGGTGGATGAGCAAACGCTCGAGACCAAATCGTGGAGACTTGGCAAACCAATTGATCGGCCCTATTGCGTTCTTGGAAGAAAGCAAAGACGCTCTTAAC
Taxonomic Information

Plant ID: NPO29532
Plant Latin Name: Vigna Angularis
Taxonomy Genus: Vigna
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 3914
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
TCM; Ayurveda

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

108 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


61 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

59 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95392

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC81970

Ingredient ID: NPC81010

Ingredient ID: NPC78599

Ingredient ID: NPC76545

Ingredient ID: NPC74146

Ingredient ID: NPC73913

Ingredient ID: NPC70744

Ingredient ID: NPC66657

Ingredient ID: NPC64250

Ingredient ID: NPC62045

Ingredient ID: NPC61477

Ingredient ID: NPC59637

Ingredient ID: NPC55830

Ingredient ID: NPC55715

Ingredient ID: NPC55412

Ingredient ID: NPC51204

Ingredient ID: NPC49680

Ingredient ID: NPC489907

Ingredient ID: NPC44802

Ingredient ID: NPC39426

Ingredient ID: NPC39102

Ingredient ID: NPC3829

Ingredient ID: NPC34103

Ingredient ID: NPC33611

Ingredient ID: NPC32977

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC312843

Ingredient ID: NPC310340

Ingredient ID: NPC302260

Ingredient ID: NPC300326

Ingredient ID: NPC29883

Ingredient ID: NPC298541

Ingredient ID: NPC294902

Ingredient ID: NPC289774

Ingredient ID: NPC289142

Ingredient ID: NPC28230

Ingredient ID: NPC281686

Ingredient ID: NPC280664

Ingredient ID: NPC279481

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC261619

Ingredient ID: NPC260584

Ingredient ID: NPC260481

Ingredient ID: NPC253481

Ingredient ID: NPC248573

Ingredient ID: NPC247457

Ingredient ID: NPC247261

Ingredient ID: NPC245490

Ingredient ID: NPC243728

Ingredient ID: NPC237812

Ingredient ID: NPC232643

Ingredient ID: NPC231149

Ingredient ID: NPC226453

Ingredient ID: NPC223016

Ingredient ID: NPC221609

Ingredient ID: NPC219876

Ingredient ID: NPC21338

Ingredient ID: NPC211175

Ingredient ID: NPC210838

Ingredient ID: NPC209846

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC20603

Ingredient ID: NPC203468

Ingredient ID: NPC201284

Ingredient ID: NPC188783

Ingredient ID: NPC185755

Ingredient ID: NPC185326

Ingredient ID: NPC183671

Ingredient ID: NPC180973

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC174056

Ingredient ID: NPC173348

Ingredient ID: NPC167400

Ingredient ID: NPC165967

Ingredient ID: NPC161571

Ingredient ID: NPC158853

Ingredient ID: NPC15703

Ingredient ID: NPC15658

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC146851

Ingredient ID: NPC14628

Ingredient ID: NPC141273

Ingredient ID: NPC137958

Ingredient ID: NPC13422

Ingredient ID: NPC133041

Ingredient ID: NPC126681

Ingredient ID: NPC126029

Ingredient ID: NPC125275

Ingredient ID: NPC123759

Ingredient ID: NPC120464

Ingredient ID: NPC119090

Ingredient ID: NPC11433

Ingredient ID: NPC113863

Ingredient ID: NPC112890

Ingredient ID: NPC110958

Ingredient ID: NPC110396

Ingredient ID: NPC108811

Ingredient ID: NPC101241