• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Laurus Nobilis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ACCACCACCGGCGAACGAGTCCCGCGGAAACGCCGCTCGCGGCCCGCGGCCCCGGGGACGACCCGGCGGCGCGCGTCCCGACGAGCTCCGAACAAACCCTCTGGGCGCGGCGAGCGCCAAGGAATAGAAGCGGAAGGGGCGGAGGCCTCGCACGGAGCGATCCGCCGCCCGTCTGTGAACCCTTTTAGACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCACCCATCGCCCCCCCCCCCGCGGCATTCCCATGCCCGGCGGGGGAGCGGAGACTGGCCGCCCGTGCCCGAGTCCTCGGCGCGCGGTCGGCTGAAAAGGAGGACACCGTGCGGCGCGACACGGCGTGTGGGGGTCTGAGAGGCGATCCGTCGCCGATCGTACGTCGCGCCCKCATTCCGCCGCGCGCAGTGTCACCCGTGGGACCGGACTCGCCCGCAGCCGCGGGCGCTCGGACCGCGACCCCAGGTCAGGCGTGGCCACCCGC

Click for details-----ITS1

ACCACCACCGGCGAACCAGTCCCGCGGAAACGCCGCTCGCGGCCCGCGGCCCCGGGGACGACCCGGCGGCGCGCGTCCCGACGAGCTCCGAACAAACCCTCTGGGCGCGGCGAGCGCCAAGGAATAGAAGCGGAAGGGGCGGAGGCCTCGCACGGAGCGATCCGCCGCCCGTCTGTGAACCCTTTTAGA

Click for details-----ITS2

CACCCATCGCCCCCCCCCCCGCGGCATTCCCATGCCCGGCGGGGGAGCGGAGACTGGCCGCCCGTGCCCGAGTCCTCGGCGCGCGGTCGGCTGAAAAGGAGGACACCGTGCGGCGCGACACGGCGTGTGGGGGTCTGAGAGGCGATCCGTCGCCGATCGTACGTCGCGCCCKCATTCCGCCGCGCGCAGTGTCACCCGTGGGACCGGACTCGCCCGCAGCCGCGGGCGCTCGGACCGCGACCCCAGGTCAGGCGTGGCCACCCGC
Taxonomic Information

Plant ID: NPO29515
Plant Latin Name: Laurus Nobilis
Taxonomy Genus: Laurus
Taxonomy Family: Lauraceae

Plant External Links:

NCBI TaxonomyDB: 85223
Plant-of-the-World-Online: 465049-1

Used in Medicines

Country/Region:
Turkey; Afghanistan; Israel; Italy; Tunisia; Lebanon; India; United States; Jordan; Chile; Greece; China; Argentina; Iraq; Spain

Traditional Medicine System:
Indian Folk; TCM; Unani


Medicinal Functions:

Abortifacient; Antirheumatic; Antiseptic; Appetizer; Aromatic; Astringent; Cancer; Carminative; Diaphoretic; Digestive; Diuretic; Emetic; Emmenagogue; Narcotic; Parasiticide; Stimulant; Stomachic

Geographical Distribution

Turkey; Afghanistan; Italy; India; France; Argentina; Israel; Algeria; China; Chile; Jordan; Iraq; Spain; Libya; United States; Morocco; Albania; Portugal; South Africa; Tunisia; Lebanon; Greece

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

75 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


64 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

45 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC98680

Ingredient ID: NPC94167

Ingredient ID: NPC88566

Ingredient ID: NPC78551

Ingredient ID: NPC58956

Ingredient ID: NPC58522

Ingredient ID: NPC55412

Ingredient ID: NPC53601

Ingredient ID: NPC490112

Ingredient ID: NPC489985

Ingredient ID: NPC489983

Ingredient ID: NPC489907

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC328005

Ingredient ID: NPC322935

Ingredient ID: NPC320537

Ingredient ID: NPC318813

Ingredient ID: NPC312918

Ingredient ID: NPC307079

Ingredient ID: NPC303522

Ingredient ID: NPC301696

Ingredient ID: NPC296337

Ingredient ID: NPC292792

Ingredient ID: NPC287657

Ingredient ID: NPC287331

Ingredient ID: NPC283274

Ingredient ID: NPC282408

Ingredient ID: NPC279026

Ingredient ID: NPC269919

Ingredient ID: NPC269206

Ingredient ID: NPC26906

Ingredient ID: NPC257124

Ingredient ID: NPC256853

Ingredient ID: NPC255042

Ingredient ID: NPC24957

Ingredient ID: NPC246165

Ingredient ID: NPC246076

Ingredient ID: NPC240757

Ingredient ID: NPC237727

Ingredient ID: NPC237031

Ingredient ID: NPC230456

Ingredient ID: NPC227017

Ingredient ID: NPC215632

Ingredient ID: NPC213749

Ingredient ID: NPC210918

Ingredient ID: NPC20791

Ingredient ID: NPC201844

Ingredient ID: NPC199914

Ingredient ID: NPC187770

Ingredient ID: NPC187107

Ingredient ID: NPC186363

Ingredient ID: NPC186324

Ingredient ID: NPC184248

Ingredient ID: NPC182840

Ingredient ID: NPC182570

Ingredient ID: NPC180871

Ingredient ID: NPC17958

Ingredient ID: NPC178638

Ingredient ID: NPC177112

Ingredient ID: NPC175987

Ingredient ID: NPC167400

Ingredient ID: NPC166362

Ingredient ID: NPC154127

Ingredient ID: NPC150950

Ingredient ID: NPC14930

Ingredient ID: NPC147983

Ingredient ID: NPC143979

Ingredient ID: NPC138113

Ingredient ID: NPC137419

Ingredient ID: NPC122212

Ingredient ID: NPC116775

Ingredient ID: NPC113079

Ingredient ID: NPC108831