• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Fallopia Multiflora


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCCAAAGCAGAGAGACCCGCGGACCGTATCCTAAACGGGCGGGCGAGGCGGGCTAGCTACGGCGAAGCCCCTTCGCTCGCCGCCGGGAGGGCTTCACCCCTCCCGGCACCAACGAAACCCCGGCGCGGATTGCGCCAAGGACCACGAACAGGAGCGCGTCCCGTGCCGCCCGGCCTCCGGGGGGTGCGGAGACGACGCGTCGTTTCTAAGAAACAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCCTCGGGCCGAGGGCACGTCTGGCTGGGCGTCACGCACAGCGTCGCCCCCACCCCCTCCGGGGGGCGAGGGGCGGAGAATGGCCCCCCGCGCGTCGCAGCACGGCCGGCCTAAACGCAGACCCCGCGGACGCGAAGCGCCGCGACGACTGGTGGTGTGCTCAGCATCGCGTCGCGTCGCCCTCGCGTCCCCGGGAGCTCAAGCCCCCTCCCGAGCGCGGTCTCTCCGGAGGCCCCGTTCGGCGGAACACG

Click for details-----ITS1

TCGAAACCTGCCCCAAAGCAGAGAGACCCGCGGACCGTATCCTAAACGGGCGGGCGAGGCGGGCTAGCTACGGCGAAGCCCCTTCGCTCGCCGCCGGGAGGGCTTCACCCCTCCCGGCACCAACGAAACCCCGGCGCGGATTGCGCCAAGGACCACGAACAGGAGCGCGTCCCGTGCCGCCCGGCCTCCGGGGGGTGCGGAGACGACGCGTCGTTTCTAAGAAACAGAA

Click for details-----ITS2

ACAGCGTCGCCCCCACCCCCTCCGGGGGGCGAGGGGCGGAGAATGGCCCCCCGCGCGTCGCAGCACGGCCGGCCTAAACGCAGACCCCGCGGACGCGAAGCGCCGCGACGACTGGTGGTGTGCTCAGCATCGCGTCGCGTCGCCCTCGCGTCCCCGGGAGCTCAAGCCCCCTCCCGAGCGCGGTCTCTCCGGAGGCCCCGTTCGGCGGAACACG
Taxonomic Information

Plant ID: NPO29417
Plant Latin Name: Fallopia Multiflora
Taxonomy Genus: Fallopia
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 76025
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea

Traditional Medicine System:
Kampo

Geographical Distribution

South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

156 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


75 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

115 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99557

Ingredient ID: NPC98777

Ingredient ID: NPC98555

Ingredient ID: NPC92403

Ingredient ID: NPC88789

Ingredient ID: NPC84827

Ingredient ID: NPC83692

Ingredient ID: NPC82512

Ingredient ID: NPC81010

Ingredient ID: NPC79943

Ingredient ID: NPC79056

Ingredient ID: NPC74374

Ingredient ID: NPC70804

Ingredient ID: NPC70744

Ingredient ID: NPC70622

Ingredient ID: NPC65994

Ingredient ID: NPC65530

Ingredient ID: NPC61477

Ingredient ID: NPC6099

Ingredient ID: NPC53680

Ingredient ID: NPC52247

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC5029

Ingredient ID: NPC48367

Ingredient ID: NPC478990

Ingredient ID: NPC478889

Ingredient ID: NPC478888

Ingredient ID: NPC478887

Ingredient ID: NPC478886

Ingredient ID: NPC478885

Ingredient ID: NPC478884

Ingredient ID: NPC478883

Ingredient ID: NPC478882

Ingredient ID: NPC478881

Ingredient ID: NPC478880

Ingredient ID: NPC478879

Ingredient ID: NPC478878

Ingredient ID: NPC478877

Ingredient ID: NPC478876

Ingredient ID: NPC478875

Ingredient ID: NPC478874

Ingredient ID: NPC478873

Ingredient ID: NPC478872

Ingredient ID: NPC478871

Ingredient ID: NPC478870

Ingredient ID: NPC46958

Ingredient ID: NPC44328

Ingredient ID: NPC43696

Ingredient ID: NPC36357

Ingredient ID: NPC331613

Ingredient ID: NPC33135

Ingredient ID: NPC32977

Ingredient ID: NPC32441

Ingredient ID: NPC3224

Ingredient ID: NPC312929

Ingredient ID: NPC311485

Ingredient ID: NPC306207

Ingredient ID: NPC30432

Ingredient ID: NPC303422

Ingredient ID: NPC302857

Ingredient ID: NPC302666

Ingredient ID: NPC294902

Ingredient ID: NPC294412

Ingredient ID: NPC294409

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288089

Ingredient ID: NPC285776

Ingredient ID: NPC282923

Ingredient ID: NPC281131

Ingredient ID: NPC281128

Ingredient ID: NPC280254

Ingredient ID: NPC270369

Ingredient ID: NPC268342

Ingredient ID: NPC268266

Ingredient ID: NPC267205

Ingredient ID: NPC262911

Ingredient ID: NPC261619

Ingredient ID: NPC257182

Ingredient ID: NPC254848

Ingredient ID: NPC254847

Ingredient ID: NPC252558

Ingredient ID: NPC252169

Ingredient ID: NPC251619

Ingredient ID: NPC250793

Ingredient ID: NPC249045

Ingredient ID: NPC248573

Ingredient ID: NPC246679

Ingredient ID: NPC245585

Ingredient ID: NPC245584

Ingredient ID: NPC243728

Ingredient ID: NPC243062

Ingredient ID: NPC242712

Ingredient ID: NPC241089

Ingredient ID: NPC240343

Ingredient ID: NPC238254

Ingredient ID: NPC236202

Ingredient ID: NPC235260

Ingredient ID: NPC234689

Ingredient ID: NPC232954

Ingredient ID: NPC230301

Ingredient ID: NPC225710

Ingredient ID: NPC224161

Ingredient ID: NPC219876

Ingredient ID: NPC209970

Ingredient ID: NPC209907

Ingredient ID: NPC209560

Ingredient ID: NPC20791

Ingredient ID: NPC204759

Ingredient ID: NPC203719

Ingredient ID: NPC201657

Ingredient ID: NPC199977

Ingredient ID: NPC196557

Ingredient ID: NPC195749

Ingredient ID: NPC19256

Ingredient ID: NPC191626

Ingredient ID: NPC190457

Ingredient ID: NPC180508

Ingredient ID: NPC179950

Ingredient ID: NPC178851

Ingredient ID: NPC176740

Ingredient ID: NPC173637

Ingredient ID: NPC169749

Ingredient ID: NPC168358

Ingredient ID: NPC167976

Ingredient ID: NPC161571

Ingredient ID: NPC15970

Ingredient ID: NPC157410

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC153500

Ingredient ID: NPC14738

Ingredient ID: NPC145885

Ingredient ID: NPC145038

Ingredient ID: NPC143011

Ingredient ID: NPC142753

Ingredient ID: NPC142319

Ingredient ID: NPC14113

Ingredient ID: NPC139746

Ingredient ID: NPC139508

Ingredient ID: NPC135088

Ingredient ID: NPC127546

Ingredient ID: NPC126029

Ingredient ID: NPC118027

Ingredient ID: NPC116775

Ingredient ID: NPC114345

Ingredient ID: NPC114327

Ingredient ID: NPC111929

Ingredient ID: NPC111888

Ingredient ID: NPC111440

Ingredient ID: NPC110899

Ingredient ID: NPC108811

Ingredient ID: NPC1075

Ingredient ID: NPC105591

Ingredient ID: NPC103540