• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hovenia Acerba


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTGCACAGCAGAACGACCCGCGAACCCGTAAAAACACACCGGGGGGCTCGGGGCCACATGCCTCGTACCCCCTTTGGTCGGGGGCTGCACCCGTGACCCGCCTGGCGGTGCACGCGTGCCGCTCTCCCGGCCGCACAAACGAACCCCGGCGCAAACCGCGCCAAGGAAAACCCAACGGATTGGCATCGCCCCGTCGCCCCAGAGATGGTGCGCGGTCGGGGTGTGCGTCGTATTCTATCAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACACAACGTTGCCCCCCCGACCCCGACCCCGAGGGCGGGGGGGCGGATGCTGGCCTCCCGTGCGCCGCGGCGAGCGGTTGGCCGAAATGCGAGTCCTCGGCGATGCGTGCCGTAACAGTCGGTGGTTGTCCAACCCTCGGTGCCTTGTTGCGTGCACGGATCGCCGTTGCGGATCGAGAGACCCCAATGCGCCGCTGCTGCGGCGTCTCCA

Click for details-----ITS1

TCGATACCTGCACAGCAGAACGACCCGCGAACCCGTAAAAACACACCGGGGGGCTCGGGGCCACATGCCTCGTACCCCCTTTGGTCGGGGGCTGCACCCGTGACCCGCCTGGCGGTGCACGCGTGCCGCTCTCCCGGCCGCACAAACGAACCCCGGCGCAAACCGCGCCAAGGAAAACCCAACGGATTGGCATCGCCCCGTCGCCCCAGAGATGGTGCGCGGTCGGGGTGTGCGTCGTATTCTATCAATGTCAAAA

Click for details-----ITS2

AACGTTGCCCCCCCGACCCCGACCCCGAGGGCGGGGGGGCGGATGCTGGCCTCCCGTGCGCCGCGGCGAGCGGTTGGCCGAAATGCGAGTCCTCGGCGATGCGTGCCGTAACAGTCGGTGGTTGTCCAACCCTCGGTGCCTTGTTGCGTGCACGGATCGCCGTTGCGGATCGAGAGACCCCAATGCGCCGCTGCTGCGGCGTCTCCA
Taxonomic Information

Plant ID: NPO29415
Plant Latin Name: Hovenia Acerba
Taxonomy Genus: Hovenia
Taxonomy Family: Rhamnaceae

Plant External Links:

NCBI TaxonomyDB: 210357
Plant-of-the-World-Online: 717557-1

Used in Medicines

Country/Region:
India

Traditional Medicine System:
Indian Folk

Geographical Distribution

India; Nepal; China; Myanmar

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

179 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


91 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

77 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99310

Ingredient ID: NPC99108

Ingredient ID: NPC97444

Ingredient ID: NPC97418

Ingredient ID: NPC96830

Ingredient ID: NPC95487

Ingredient ID: NPC94610

Ingredient ID: NPC92754

Ingredient ID: NPC89747

Ingredient ID: NPC89442

Ingredient ID: NPC87061

Ingredient ID: NPC85990

Ingredient ID: NPC85813

Ingredient ID: NPC85379

Ingredient ID: NPC85346

Ingredient ID: NPC82623

Ingredient ID: NPC81559

Ingredient ID: NPC80985

Ingredient ID: NPC7943

Ingredient ID: NPC77674

Ingredient ID: NPC77249

Ingredient ID: NPC76256

Ingredient ID: NPC75975

Ingredient ID: NPC75236

Ingredient ID: NPC7523

Ingredient ID: NPC74296

Ingredient ID: NPC73592

Ingredient ID: NPC73021

Ingredient ID: NPC71002

Ingredient ID: NPC6941

Ingredient ID: NPC68324

Ingredient ID: NPC68040

Ingredient ID: NPC63094

Ingredient ID: NPC62765

Ingredient ID: NPC59884

Ingredient ID: NPC57639

Ingredient ID: NPC55681

Ingredient ID: NPC52754

Ingredient ID: NPC51443

Ingredient ID: NPC43217

Ingredient ID: NPC3964

Ingredient ID: NPC34930

Ingredient ID: NPC34700

Ingredient ID: NPC312134

Ingredient ID: NPC311317

Ingredient ID: NPC307063

Ingredient ID: NPC306414

Ingredient ID: NPC305835

Ingredient ID: NPC305826

Ingredient ID: NPC304929

Ingredient ID: NPC302760

Ingredient ID: NPC301585

Ingredient ID: NPC300581

Ingredient ID: NPC299948

Ingredient ID: NPC297836

Ingredient ID: NPC296572

Ingredient ID: NPC294548

Ingredient ID: NPC293378

Ingredient ID: NPC293064

Ingredient ID: NPC292419

Ingredient ID: NPC29152

Ingredient ID: NPC290791

Ingredient ID: NPC290598

Ingredient ID: NPC290402

Ingredient ID: NPC287935

Ingredient ID: NPC287131

Ingredient ID: NPC28657

Ingredient ID: NPC285404

Ingredient ID: NPC279505

Ingredient ID: NPC279461

Ingredient ID: NPC278070

Ingredient ID: NPC278023

Ingredient ID: NPC27765

Ingredient ID: NPC267193

Ingredient ID: NPC264145

Ingredient ID: NPC26193

Ingredient ID: NPC261831

Ingredient ID: NPC260491

Ingredient ID: NPC259563

Ingredient ID: NPC257695

Ingredient ID: NPC257191

Ingredient ID: NPC254509

Ingredient ID: NPC25150

Ingredient ID: NPC251379

Ingredient ID: NPC245418

Ingredient ID: NPC244557

Ingredient ID: NPC24404

Ingredient ID: NPC243728

Ingredient ID: NPC239644

Ingredient ID: NPC237846

Ingredient ID: NPC235341

Ingredient ID: NPC23217

Ingredient ID: NPC230301

Ingredient ID: NPC228383

Ingredient ID: NPC227485

Ingredient ID: NPC225789

Ingredient ID: NPC225710

Ingredient ID: NPC220912

Ingredient ID: NPC220210

Ingredient ID: NPC219876

Ingredient ID: NPC217263

Ingredient ID: NPC216630

Ingredient ID: NPC215758

Ingredient ID: NPC215589

Ingredient ID: NPC214770

Ingredient ID: NPC214425

Ingredient ID: NPC21209

Ingredient ID: NPC209970

Ingredient ID: NPC20791

Ingredient ID: NPC201579

Ingredient ID: NPC199620

Ingredient ID: NPC197645

Ingredient ID: NPC196924

Ingredient ID: NPC195419

Ingredient ID: NPC195366

Ingredient ID: NPC194856

Ingredient ID: NPC194364

Ingredient ID: NPC192638

Ingredient ID: NPC190901

Ingredient ID: NPC188910

Ingredient ID: NPC188668

Ingredient ID: NPC186107

Ingredient ID: NPC185136

Ingredient ID: NPC18457

Ingredient ID: NPC18285

Ingredient ID: NPC180311

Ingredient ID: NPC178158

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC175794

Ingredient ID: NPC17461

Ingredient ID: NPC173637

Ingredient ID: NPC169479

Ingredient ID: NPC169392

Ingredient ID: NPC166825

Ingredient ID: NPC165266

Ingredient ID: NPC165005

Ingredient ID: NPC164981

Ingredient ID: NPC163076

Ingredient ID: NPC16287

Ingredient ID: NPC159518

Ingredient ID: NPC156654

Ingredient ID: NPC156255

Ingredient ID: NPC154186

Ingredient ID: NPC152971

Ingredient ID: NPC152162

Ingredient ID: NPC150402

Ingredient ID: NPC149184

Ingredient ID: NPC148192

Ingredient ID: NPC147983

Ingredient ID: NPC146550

Ingredient ID: NPC144909

Ingredient ID: NPC144054

Ingredient ID: NPC143332

Ingredient ID: NPC141481

Ingredient ID: NPC140932

Ingredient ID: NPC139472

Ingredient ID: NPC139206

Ingredient ID: NPC136514

Ingredient ID: NPC1321

Ingredient ID: NPC130590

Ingredient ID: NPC126029

Ingredient ID: NPC124624

Ingredient ID: NPC12309

Ingredient ID: NPC12241

Ingredient ID: NPC117176

Ingredient ID: NPC116775

Ingredient ID: NPC116520

Ingredient ID: NPC115672

Ingredient ID: NPC114743

Ingredient ID: NPC110923

Ingredient ID: NPC108628

Ingredient ID: NPC107704

Ingredient ID: NPC104679

Ingredient ID: NPC104222

Ingredient ID: NPC102617

Ingredient ID: NPC102058

Ingredient ID: NPC101822

Ingredient ID: NPC101475