CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Lotus Polyphyllos

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGTATCCTTGCAAACAAACCAACTTGTAAACTCGTTTGACTATTTGGGCATGCTTGGGGTGTATCCCACCCTAACTTCCCAATTTAGGGGGAAACCACANTGGGGTCTCCTCCTAATAAATAACAAACCCCGGCGCTTGATGCGTCAAGGAACTGAAATTGTTTGTTGCACTCTTGTCGGCCCGGATACGGTGCTTGTGCAAGAGTTGCCATGACACATTCTACATAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAACCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACACATCGTTGCCCCAACGCCAAACGCTTAGTGCTTTGTGGCGTGTGGGGTGAATGTTGGCCTCCCGTGAGTTCAGGCTCGCGGTTGGTTTAAAATTGGGTCCATGGTGAAGTATGCCATGATGGATGGTGGCTGAGTAATGCTCGAGACCAATCATGGGAAACTTTATCTTGCTTGGGCTCTATAACCCGTATGTGTGTTAAAAACGCTCACAA

Click for details-----ITS1

Click for details-----ITS2

ATCGTTGCCCCAACGCCAAACGCTTAGTGCTTTGTGGCGTGTGGGGTGAATGTTGGCCTCCCGTGAGTTCAGGCTCGCGGTTGGTTTAAAATTGGGTCCATGGTGAAGTATGCCATGATGGATGGTGGCTGAGTAATGCTCGAGACCAATCATGGGAAACTTTATCTTGCTTGGGCTCTATAACCCGTATGTGTGTTAAAAACGCTCACAA

Taxonomic Information

Plant ID: NPO29369
Plant Latin Name: Lotus Polyphyllos
Taxonomy Genus: Lotus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

6 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

1 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

4 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC48034

Ingredient ID: NPC46274

Ingredient ID: NPC20791

Ingredient ID: NPC181592

Ingredient ID: NPC169749

Ingredient ID: NPC127624

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Cysteine protease	CASP6	Caspase-6	P55212	CHEMBL3308
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Isomerase	TOP2A	DNA topoisomerase II alpha	P11388	CHEMBL1806
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	GLO1	Glyoxalase I	Q04760	CHEMBL2424
Therapeutic Target	Methyl-lysine/arginine binding protein	L3MBTL1	Lethal(3)malignant brain tumor-like protein 1	Q9Y468	CHEMBL1287622
Therapeutic Target	Oxidoreductase	HSD17B10	Endoplasmic reticulum-associated amyloid beta-peptide-binding protein	Q99714	CHEMBL4159
Therapeutic Target	Oxidoreductase	HSD17B2	Estradiol 17-beta-dehydrogenase 2	P37059	CHEMBL2789
Therapeutic Target	Peptide receptor (family A GPCR)	NPSR1	Neuropeptide S receptor	Q6W5P4	CHEMBL5162
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	AXL	Tyrosine-protein kinase receptor UFO	P30530	CHEMBL4895
Therapeutic Target	Protein Kinase	YES1	Tyrosine-protein kinase YES	P07947	CHEMBL2073
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	AURKB	Serine/threonine-protein kinase Aurora-B	Q96GD4	CHEMBL2185
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	FLT3	Tyrosine-protein kinase receptor FLT3	P36888	CHEMBL1974
Therapeutic Target	Protein Kinase	CDK1	Cyclin-dependent kinase 1	P06493	CHEMBL308
Therapeutic Target	Protein Kinase	PIM1	Serine/threonine-protein kinase PIM1	P11309	CHEMBL2147
Therapeutic Target	Serine protease	F2	Thrombin	P00734	CHEMBL204
Therapeutic Target	Transcription factor	AHR	Aryl hydrocarbon receptor	P35869	CHEMBL3201

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	21

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01438320	Q-Trial in Patients With Hepatitis C	chronic hepatitis C virus infection	Quercetin (NPC20791)	NP level
NCT03989271	Biological Effects of Quercetin in COPD	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT01708278	Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD)	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT02848131	Senescence in Chronic Kidney Disease	chronic kidney disease	Quercetin (NPC20791)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Quercetin (NPC20791)	NP level
NCT01720147	Quercetin in Children With Fanconi Anemia; a Pilot Study	Fanconi anemia	Quercetin (NPC20791)	NP level
NCT05456022	Therapeutic Efficacy of Quercetin Versus Its Encapsulated Nanoparticle on Tongue Squamous Cell Carcinoma Cell Line	mouth neoplasm	Quercetin (NPC20791)	NP level
NCT01348204	Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators	cystic fibrosis	Quercetin (NPC20791)	NP level
NCT05062486	A Study to Evaluate the Safety and Efficacy of RQC for AMD	age-related macular degeneration	Quercetin (NPC20791)	NP level
NCT04853199	Quercetin In The Treatment Of SARS-COV 2	COVID-19	Quercetin (NPC20791)	NP level
NCT04907253	Quercetin in Coronary Artery By-pass Surgery	coronary artery disease	Quercetin (NPC20791)	NP level
NCT02226484	Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD?	gastroesophageal reflux disease	Quercetin (NPC20791)	NP level
NCT01375101	Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus	oral lichen planus	Quercetin (NPC20791)	NP level
NCT04851821	The Effectiveness of Phytotherapy in SARS-COV2(COVID-19)	COVID-19	Quercetin (NPC20791)	NP level
NCT03943459	Sirtuin-1 and Advanced Glycation End-products in Postmenopausal Women With Coronary Disease	coronary artery disease	Quercetin (NPC20791)	NP level
NCT01839344	Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes.	type 2 diabetes mellitus	Quercetin (NPC20791)	NP level
NCT04946383	Safety and Effectivness of Quercetin & Dasatinib on Epigenetic Aging	aging	Quercetin (NPC20791)	NP level
NCT01912820	Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery	prostate adenocarcinoma	Quercetin (NPC20791)	NP level
NCT05276895	Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis	osteoarthritis	Quercetin (NPC20791)	NP level
NCT05422885	Safety and Feasibility of Dasatinib and Quercetin in Adults at Risk for Alzheimer's Disease	aging	Quercetin (NPC20791)	NP level
NCT04733534	An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer	childhood cancer	Quercetin (NPC20791)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	TOP2A,FLT3,MET,AXL,ALOX5,CDK1,KDR,IGF1R,EGFR
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	L3MBTL1,IGF1R,SRC,AURKB,NOX4,CYP19A1,CA12,TOP2A,CDK1
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	NPSR1,AURKB,NOX4,CYP19A1,F2,TOP2A,MET,CDK1,ALOX15
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	ALOX5,CYP1B1,NOX4,CA12,DPP4,MET,XDH,CA7
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	KDR,MET,FLT3,IGF1R,TOP2A,EGFR,TP53
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	PIM1,AURKB,FLT3,SRC,AXL,TP53,TOP2A
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	CDK1,TP53,DPP4,SRC,TOP2A,FLT3,AURKB
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	NPSR1,AURKB,NOX4,TOP2A,ACHE,CDK1,ALOX15
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CSNK2A3,CYP1B1,CYP19A1,CA12,DPP4,MET,KDR
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE,KDR,TOP2A,SNCA,FLT3,MET
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	SRC,KDR,TOP2A,TP53,MET,FLT3
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	TOP2A,CSNK2A1,KDR,IGF1R,MET,EGFR
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	MET,TP53,EGFR,KDR,TOP2A,SRC
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	IGF1R,KDR,SRC,AHR,FLT3,AXL
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	SNCA,NOX4,ELAVL3,MET,ACHE,XDH
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CYP1A1,NPSR1,NOX4,F2,MET,TYR
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP1A1,AURKB,CA12,TOP2A,MET,CYP1A2
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDR,AXL,AHR,TP53,EGFR
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	TOP2A,AHR,ALOX5,FLT3,DPP4
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	KDR,TP53,TOP2A,EGFR,MET
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	TOP2A,IGF1R,TP53,EGFR,SRC
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	CYP19A1,DPP4,MET,ACHE,AXL
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AURKB,CA12,TOP2A,CDK1,XDH
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AURKB,TOP2A,CYP2C9,CDK1,CYP1A2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CYP1A1,CYP2C9,ELAVL3,ACHE,ALOX15
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	AURKB,CA12,TOP2A,ELAVL3,CDK1
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MET,TP53,EGFR,KDR
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	MET,KDR,SRC,F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	ALOX5,F2,AHR,KDR
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	SRC,FLT3,KDR,TP53
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	EGFR,SRC,TP53,AXL
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	TYR,EGFR,MET,KDR
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12,TOP2A,CDK1,HSD17B2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	NPSR1,AURKB,NOX4,F2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	DPP4,SRC,SNCA,ACHE
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	AXL,CYP19A1,EGFR,XDH
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE,MET,AXL,HSD17B2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ALOX5,IGF1R,ACHE
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	KDR,EGFR,MET
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2,DPP4 NCT01839344
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	TOP2A,F2,SRC
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AURKB,DPP4,KDR
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SNCA,SRC,ACHE
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR,CDK1,ALOX5
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	FLT3,EGFR,KDR
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MET,KDR,EGFR
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	ALOX5,GLO1,XDH
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	TOP2A,CA12,CYP2C9
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR,MET,EGFR
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	IGF1R,XDH NCT02848131
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2,TOP2A,ALOX5
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4,TP53,MET
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	CDK1,TOP2A,FLT3
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	KDR,MET,SRC
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,ALOX15 NCT01912820
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	NOX4,DPP4,FLT3
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	IGF1R,ABCG2,NOX4
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CYP1A1,YES1,ACHE
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	MET,FLT3,AXL
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1,NOX4,DPP4
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	KDR,ALOX5,CSNK2A2,FLT3,CA7,ALOX15,SNCA,PIM1,RECQL,CA12,DPP4,APEX1,EGFR,SRC,TDP1,TYR,AHR,HSD17B2,AXL,AURKB,TOP2A,MET,CDK1,XDH,CASP6
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	HSD17B10,CSNK2A2,NOX4,RECQL,CA12,GLO1,APEX1,EGFR,CDK1,SRC,CISD1,TDP1,AHR,AXL,AURKB,TOP2A,MET,ACHE,TP53,KDR,CASP6
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	APEX1,AHR,SRC,TP53,CDK1,PIM1,YES1,MET,EGFR,CSNK2A1,CA12,KDR,AXL,FLT3,IGF1R,AURKB,POLB,ALOX5,XDH,TOP2A
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ALOX5,CYP1B1,NPSR1,CYP2C9,CA7,ALOX15,ABCG2,SNCA,PIM1,RECQL,DPP4,POLB,CISD1,AXL,HSD17B2,AURKB,F2,MET,ACHE,XDH
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR,SRC
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	ALOX5,SRC
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	SRC,IGF1R
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	EGFR,MET
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	TOP2A NCT00455416
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	TP53,SRC
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FLT3,TOP2A
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TOP2A,TP53
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	MET,KDR
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FLT3,SRC
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	MET,ACHE
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KDR,SRC
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	ALOX5,AHR
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4,F2
NA Disease Category: NA Disease ICD-11 Code: NA	NOX4,MET
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2,EGFR
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	SRC,FLT3
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	SRC,KDR
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	TOP2A,EGFR
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	APEX1,IGF1R
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	TP53,SRC
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	TP53,SRC
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	ALOX5,FLT3
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R,ALOX5
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	ALOX5,ABCG2
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	TOP2A,F2
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04851821,NCT04853199
coronary artery disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA8Y-BA8Z	NCT03943459,NCT04907253
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NCT01708278,NCT03989271
Ageing associated decline in intrinsic capacity Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG2A	NCT05422885,NCT04946383
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1,CDK1
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	CYP2C9,PIM1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE,AXL
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	AURKB,ABCG2
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1,TOP2A
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	ABCG2,F2
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1,ABCG2
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	NOX4,AHR
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HSD17B10,NPSR1,CA7,ALOX15,DPP4,YES1,GLO1,POLB,CISD1,TDP1,HSD17B2,AURKB,CYP19A1,TOP2A,ELAVL3,MET,TP53,XDH,CASP6
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A3,ALOX5,NOX4,CYP1A2,ALOX15,CA12,ALOX12,YES1,GLO1,APEX1,CISD1,TDP1,AHR,HSD17B2,ELAVL3,MET,TP53,XDH,CASP6
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	KDR,ALOX5,NPSR1,NOX4,CYP2C9,ABCG2,SNCA,CA12,ALOX12,DPP4,GLO1,AHR,HSD17B2,F2,MET,ACHE,CDK1,XDH,CASP6
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ALOX5,AURKB,CYP19A1,TOP2A,CYP2C9,MET,ACHE,XDH,TYR,ALOX5,AURKB,F2,TOP2A
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	L3MBTL1,AURKB,NOX4,CYP19A1,CA12,TOP2A,CDK1,SRC,CYP19A1,AURKB,CA12,TOP2A,CDK1
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	L3MBTL1,IGF1R,CDK1,CSNK2A3,ALOX5,SRC,AURKB,NOX4,ALOX12,TOP2A,ELAVL3,TP53
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	SNCA,AURKB,NOX4,CYP19A1,CA12,DPP4,TOP2A,GLO1,MET,CDK1,CA7,HSD17B2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CYP19A1,KDR,SRC,AXL,IGF1R,CA12,EGFR,TOP2A,MET,CDK1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA7,NPSR1,AURKB,CA12,ALOX12,CYP2C9,F2,TOP2A,CDK1,XDH
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA7,NPSR1,AURKB,CA12,F2,CYP2C9,TOP2A,ACHE,CDK1,XDH
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP1A1,NPSR1,AURKB,F2,TOP2A,CYP2C9,HSD17B2,CDK1,XDH,ALOX15
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HSD17B10,CYP1B1,DPP4,CYP2C9,CISD1,FLT3,APEX1,HSD17B2,ACHE,ALOX15
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Chemoprotection Disease Category: NA Disease ICD-11 Code: N.A.	TOP2A
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Gonococcal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A70-1A7Z	TOP2A
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	TYR
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Anogenital warts Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A95	TOP2A
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Otitis externa Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA00-AA13	TOP2A
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	ALOX5
HIV-infected patients with tuberculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1B10-1B14	TOP2A
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	AXL
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	FLT3
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	FLT3
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Syphilis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A61-1A6Z	TOP2A
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Otitis media Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA80-AB0Z	TOP2A
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	FLT3
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	ABCG2
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Respiratory system disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB40-CB7Z	TOP2A
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Filariasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F66	ALOX5
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	FLT3
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	FLT3
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	FLT3
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	ALOX5
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	FLT3
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Kaposi sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B57	TOP2A
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AURKB
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4
Common warts Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E80	TOP2A
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	FLT3
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	EGFR
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Ocular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D00-2D07	APEX1
Urinary tract infection Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC08	TOP2A
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Ureteral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C92	AHR
Macular degeneration Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B75	NCT05062486
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	NCT05276895
Gastro-oesophageal reflux disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA22	NCT02226484
Malignant neoplasms of other or unspecified parts of mouth Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B66	NCT05456022
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT04733534
Congenital aplastic anaemia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A70.0	NCT01720147
Cystic fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA25	NCT01348204
Lichen planus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA91	NCT01375101
Chronic hepatitis C Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E51.1	NCT01438320
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	NOX4
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	NOX4
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Dilated cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.0	ABCG2
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Lotus Polyphyllos

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

6 All known Ingredients in Total

1 Ingredients with Acceptable Bioavailablity

4 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Lung cancer

Hepatoblastoma

Adenocarcinoma of stomach

Malignant neoplasms of thyroid gland, unspecified

Colorectal cancer

Acute myeloid leukaemia

Malignant haematopoietic neoplasm

Malignant neoplasms of oesophagus

Glioblastoma of brain

Alzheimer disease

Ovarian cancer

Liver cancer

Brain cancer

Multiple myeloma

Pheochromocytoma

Other specified malignant neoplasms ofcolon

Renal cell carcinoma, chromophobe type

Myelodysplastic syndrome

Psoriasis

Stomach cancer

Pancreatic cancer

West Nile virus infection

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Cytomegaloviral disease

Invasive carcinoma of breast

Head and neck cancer

Cardiovascular disease

Thrombocytopenia

Peritoneal cancer

Mature B-cell leukaemia

Melanoma

Osteoarthritis, unspecified

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Superficial ovarian endometriosis

Chikungunya virus disease

Ebola virus disease

Pain, unspecified

Metastatic lymph node neoplasm

Type 2 diabetes mellitus

Multiple sclerosis

Acute diabete complication

Parkinsonism

Nasopharyngeal cancer

Chronic pain

Renal cell carcinoma

Influenza

Bacterial infection

Non-small cell lung cancer

Chronic kidney disease

Asthma

Chronic arterial occlusive disease

Mature B-cell lymphoma

Pleomorphic sarcoma

Adenocarcinoma of prostate

Leishmaniasis

Melanoma of skin

Systemic lupus erythematosus

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Carpal tunnel syndrome

Mesothelioma of pleura

Diffuse large B-cell lymphomas