• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sarcandra Glabra


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTAGAAGAAAAATGTCGTCACAGTGTCTCTTAGGTGAACTGGGAGGCCATTGTCGAAACTGTGCAAGCAGAACGACCCGTGAACCGTCTAGACATTTCGTTCATCGGGAGAGCTTGTGTGCAGGAGACTGTGCATTGTCTCTCATCGCGTGTGGTCCCCGTTCCCCTTATGCGACCCTTCTCGCGTTGGGGTGGGGCGCGGGGCGATTGTGTGCTTCTACCGAACAACGACCACCGGCGCAGTTTGCGCCAAGGATTACTATCGGAATGGGCGAGATCTCTGGACAGAGATCCTCACGGAGAGATGTTGCGTGACCTCTCCTGTCTCCGATCATTTGTACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACCTTACGTCGCTCTCAAACAATTGTCCCCCTCGGGGATGTCGAGATGAGATGCGGAGATTGGCCACCCGCGCTCTGTTCGCGCCTGGTCAAGAGCGCTTGCCGGTGCGGGCGCGATTAGTTGTGGATGATAGAAGCTACATTTCGGTGATCGCGTCCTGCGACCGTCTTTGGACCTTACCTGATGTCTTTTATGGATTCTGACTGCGACCCCAGTCAGGCGGGCCCCCTGAGATTAAACATATATATATGAGCAGAAAAA

Click for details-----ITS1

GTAGAAGAAAAATGTCGTCACAGTGTCTCTTAGGTGAACTGGGAGGCCATTGTCGAAACTGTGCAAGCAGAACGACCCGTGAACCGTCTAGACATTTCGTTCATCGGGAGAGCTTGTGTGCAGGAGACTGTGCATTGTCTCTCATCGCGTGTGGTCCCCGTTCCCCTTATGCGACCCTTCTCGCGTTGGGGTGGGGCGCGGGGCGATTGTGTGCTTCTACCGAACAACGACCACCGGCGCAGTTTGCGCCAAGGATTACTATCGGAATGGGCGAGATCTCTGGACAGAGATCCTCACGGAGAGATGTTGCGTGACCTCTCCTGTCTCCGATCATTTGTA

Click for details-----ITS2

CTTACGTCGCTCTCAAACAATTGTCCCCCTCGGGGATGTCGAGATGAGATGCGGAGATTGGCCACCCGCGCTCTGTTCGCGCCTGGTCAAGAGCGCTTGCCGGTGCGGGCGCGATTAGTTGTGGATGATAGAAGCTACATTTCGGTGATCGCGTCCTGCGACCGTCTTTGGACCTTACCTGATGTCTTTTATGGATTCTGACTGCGACCCCAGTCAGGCGGGCCCCCTGAGATTAAACATATATATATGAGCAGAAAAA
Taxonomic Information

Plant ID: NPO29221
Plant Latin Name: Sarcandra Glabra
Taxonomy Genus: Sarcandra
Taxonomy Family: Chloranthaceae

Plant External Links:

NCBI TaxonomyDB: 92927
Plant-of-the-World-Online: 167899-1

Used in Medicines

Country/Region:
Thailand; China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

South Africa; Philippines; India; Cambodia; Vietnam; China; Laos; Sri Lanka; Japan; Taiwan; Thailand

Geographical Distribution
+
−
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

91 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


42 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

45 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99675

Ingredient ID: NPC95427

Ingredient ID: NPC95162

Ingredient ID: NPC95008

Ingredient ID: NPC92774

Ingredient ID: NPC82251

Ingredient ID: NPC81775

Ingredient ID: NPC76336

Ingredient ID: NPC70616

Ingredient ID: NPC68951

Ingredient ID: NPC61

Ingredient ID: NPC58029

Ingredient ID: NPC57187

Ingredient ID: NPC52382

Ingredient ID: NPC52086

Ingredient ID: NPC47993

Ingredient ID: NPC472271

Ingredient ID: NPC469532

Ingredient ID: NPC469381

Ingredient ID: NPC45960

Ingredient ID: NPC43508

Ingredient ID: NPC309987

Ingredient ID: NPC309355

Ingredient ID: NPC306470

Ingredient ID: NPC302857

Ingredient ID: NPC302629

Ingredient ID: NPC294902

Ingredient ID: NPC293378

Ingredient ID: NPC278068

Ingredient ID: NPC275810

Ingredient ID: NPC273603

Ingredient ID: NPC273032

Ingredient ID: NPC270578

Ingredient ID: NPC269087

Ingredient ID: NPC268707

Ingredient ID: NPC267026

Ingredient ID: NPC257955

Ingredient ID: NPC257885

Ingredient ID: NPC257853

Ingredient ID: NPC248056

Ingredient ID: NPC247583

Ingredient ID: NPC242588

Ingredient ID: NPC242451

Ingredient ID: NPC240722

Ingredient ID: NPC239961

Ingredient ID: NPC239903

Ingredient ID: NPC237532

Ingredient ID: NPC236142

Ingredient ID: NPC235260

Ingredient ID: NPC235117

Ingredient ID: NPC224651

Ingredient ID: NPC223629

Ingredient ID: NPC219428

Ingredient ID: NPC216330

Ingredient ID: NPC213197

Ingredient ID: NPC211607

Ingredient ID: NPC209420

Ingredient ID: NPC209180

Ingredient ID: NPC20791

Ingredient ID: NPC206095

Ingredient ID: NPC206007

Ingredient ID: NPC198992

Ingredient ID: NPC196921

Ingredient ID: NPC187335

Ingredient ID: NPC186808

Ingredient ID: NPC18074

Ingredient ID: NPC176740

Ingredient ID: NPC167976

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC156502

Ingredient ID: NPC15095

Ingredient ID: NPC150648

Ingredient ID: NPC150291

Ingredient ID: NPC148835

Ingredient ID: NPC148800

Ingredient ID: NPC147654

Ingredient ID: NPC146479

Ingredient ID: NPC143193

Ingredient ID: NPC137949

Ingredient ID: NPC126200

Ingredient ID: NPC125979

Ingredient ID: NPC124916

Ingredient ID: NPC124897

Ingredient ID: NPC121423

Ingredient ID: NPC120784

Ingredient ID: NPC118078

Ingredient ID: NPC116775

Ingredient ID: NPC1075

Ingredient ID: NPC106446

Ingredient ID: NPC101098

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target TypeProtein ClassGene IDProtein NameUniprot IDTarget ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Therapeutic Target Enzyme NOX4 NADPH oxidase 4 Q9NPH5 CHEMBL1250375
Therapeutic Target Enzyme ALOX12 Arachidonate 12-lipoxygenase P18054 CHEMBL3687
Therapeutic Target Enzyme APEX1 DNA-(apurinic or apyrimidinic site) lyase P27695 CHEMBL5619
Therapeutic Target Enzyme POLB DNA polymerase beta P06746 CHEMBL2392
Therapeutic Target Hydrolase ACHE Acetylcholinesterase P22303 CHEMBL220
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA14 Carbonic anhydrase XIV Q9ULX7 CHEMBL3510
Showing 1 to 10 of 34 entries
Previous1234Next
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level41
Clinical trial details
NCT IDTitleConditionForm in clinical useAssociated by plant or compound
NCT00249951 Alkaline Citrate Treatment to Lower the Risk of Nephrocalcinosis in Preterm Infants Nephrocalcinosis Citric Acid (NPC293378) NP level
NCT00455416 Dietary Intervention in Follicular Lymphoma follicular lymphoma Quercetin (NPC20791) NP level
NCT01012349 Efficacy and Safety Clinical Trial of the Combination of Acetylsalicylic Acid, Sodium Bicarbonate and Citric Acid, Produced by Geolab Pharmaceutical Industries Ltd., Compared to Acetylsalicylic Acid (Aspirin ® - Bayer) in Patients With Episodic Tension-type Headache. Tension-type headache Citric Acid (NPC293378) NP level
NCT01321164 Fumaric Acid Versus Fumaric Acid Plus Narrow Band Type B Ultraviolet (UVB) for Psoriasis psoriasis Fumaric Acid (NPC224651) NP level
NCT01348204 Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators cystic fibrosis Quercetin (NPC20791) NP level
NCT01352988 Efficacy and Safety of Fumaric Acid Esters (Fumaderm®) in the Treatment of Patients With Cutaneous Lupus Erythematosus cutaneous lupus erythematosus Fumaric Acid (NPC224651) NP level
NCT01375101 Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus oral lichen planus Quercetin (NPC20791) NP level
NCT01421160 Regulating Urine pH Levels to Alleviate Chronic Joint Pain osteoarthritis Citric Acid (NPC293378) NP level
NCT01438320 Q-Trial in Patients With Hepatitis C chronic hepatitis C virus infection Quercetin (NPC20791) NP level
NCT01602068 Safety and Efficacy of Iontophoretic Dexamethasone Phosphate Delivery Prior to Implantation of a Posterior Chamber IOL cataract Citric Acid (NPC293378) NP level
Showing 1 to 10 of 41 entries
Previous12345Next

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 MMP2
Acquired hypermelanosis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED60
 TYR
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 TYR
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 AKR1B1,KDR,AURKB,DPP4
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 AURKB,AXL,FLT3,TP53,SRC,PIM1,NFKB1
Acute/subacute hepatic failure
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB91
 NFKB1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA12,ACHE,NPSR1,TSHR,MMP9,CA9,CYP2C9,XDH,MMP1,CDK1,AURKB,CA7
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 ACHE,SNCA,CA2,MMP1,ALOX15,CA7,ABCG2,AURKB,CA9,XDH,POLB,RECQL,DPP4,PIM1,CISD1,MMP2,HSD17B2,CYP1B1,CYP2C9,APP,ALOX5,CA14,MET,AXL,NPSR1
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 NOX4,ALOX15
 NCT01912820
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 NPSR1,NOX4,CYP19A1,MMP9,MMP1,ALOX15,CDK1,MET,AURKB
Showing 1 to 10 of 234 entries
Previous12345…24Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group