• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Primula Veris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTTCAGAGGGAAAACCTAGGGAAGGATCTTTGTTGAAAACTGTAAAGTTGCATGACCCATAAACTTAGTATATAAATCGGGGAGGGCACCGGAACAGTCCTTGGACCTTTCCTTGTCCATCCTCGCTGGGTGAGTGTGTGCTCGTTGTCTCCCACAGGGGGGCCTTGTGTACACATTTCCTGGCAAAGCAACGAACCCCGGCGCGATCCGCGTCAAGGAAATTCAACAAATAGATTGCGCTCCTTGCTCCCGTTCGCGGGCTATTACGAGTGTAAGAATCTTGCATATAACAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACATAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGTCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCTCTCATAATGCGTCGCTACACACCAAATCTCATTAGGGCATTGGTGCTTGAAGCGGATACTGGCTCCCCGTGTGCACTAGTGCGCGGTCGGCCTAAAAACGAGTCCTGATGATCGACGTCGTGGCAAGTGGTGGTTGTAAAGACTGTTTCATGCTGTCGTGCACGTTTCGTTCGTTATCGGGAGTCTCATTGACCCTGTAGCGCCATTTGCTTGGTGCCTCGA

Click for details-----ITS1

TTTCAGAGGGAAAACCTAGGGAAGGATCTTTGTTGAAAACTGTAAAGTTGCATGACCCATAAACTTAGTATATAAATCGGGGAGGGCACCGGAACAGTCCTTGGACCTTTCCTTGTCCATCCTCGCTGGGTGAGTGTGTGCTCGTTGTCTCCCACAGGGGGGCCTTGTGTACACATTTCCTGGCAAAGCAACGAACCCCGGCGCGATCCGCGTCAAGGAAATTCAACAAATAGATTGCGCTCCTTGCTCCCGTTCGCGGGCTATTACGAGTGTAAGAATCTTGCATATAACAAAA

Click for details-----ITS2

ATAATGCGTCGCTACACACCAAGTCTCATTAGGGCATTGGTGCTTGAAGCGGATATTGGCTCCCCGTGTGCACTAGTGCGCGGTCGGCCTAAAAACGAGTCCTGATGATCGACGTCGTGGCAAGTGGTGGTTGTAAAGACTATTTCATGCTGTCGTGCACGTTTCGTTCGTTATCGGGAGTCTCATTGACCCTGTAGCGCCATTTGCTTGGTGCCTCGATCGTGACCCC
Taxonomic Information

Plant ID: NPO29219
Plant Latin Name: Primula Veris
Taxonomy Genus: Primula
Taxonomy Family: Primulaceae

Plant External Links:

NCBI TaxonomyDB: 170927
Plant-of-the-World-Online: 702751-1

Used in Medicines

Country/Region:
Romania; Albania; Lithuania; Finland; Lebanon; China; Bulgaria

Traditional Medicine System:
TCM


Medicinal Functions:

Anodyne; Antianxiety; Antiecchymotic; Antiinflammatory; Antispasmodic; Diaphoretic; Diuretic; Expectorant; Sedative; Sternutatory

Geographical Distribution

Italy; Lithuania; France; Ireland; Norway; Belarus; Algeria; China; Belgium; Germany; Ukraine; Netherlands; Denmark; Poland; Finland; Sweden; Switzerland; Russia; Bulgaria; Romania; Albania; Lebanon; United Kingdom; Austria; Greece; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

105 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


20 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

42 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC9634

Ingredient ID: NPC9498

Ingredient ID: NPC90769

Ingredient ID: NPC90096

Ingredient ID: NPC88740

Ingredient ID: NPC85376

Ingredient ID: NPC82847

Ingredient ID: NPC81698

Ingredient ID: NPC77955

Ingredient ID: NPC77719

Ingredient ID: NPC7645

Ingredient ID: NPC74418

Ingredient ID: NPC7095

Ingredient ID: NPC69394

Ingredient ID: NPC68464

Ingredient ID: NPC6332

Ingredient ID: NPC62307

Ingredient ID: NPC60509

Ingredient ID: NPC57954

Ingredient ID: NPC57030

Ingredient ID: NPC5290

Ingredient ID: NPC41518

Ingredient ID: NPC35659

Ingredient ID: NPC312971

Ingredient ID: NPC307615

Ingredient ID: NPC307122

Ingredient ID: NPC306799

Ingredient ID: NPC304876

Ingredient ID: NPC300414

Ingredient ID: NPC295835

Ingredient ID: NPC294438

Ingredient ID: NPC2907

Ingredient ID: NPC288230

Ingredient ID: NPC288056

Ingredient ID: NPC287207

Ingredient ID: NPC286146

Ingredient ID: NPC279370

Ingredient ID: NPC275861

Ingredient ID: NPC272713

Ingredient ID: NPC271974

Ingredient ID: NPC267691

Ingredient ID: NPC265395

Ingredient ID: NPC261096

Ingredient ID: NPC26033

Ingredient ID: NPC257213

Ingredient ID: NPC256142

Ingredient ID: NPC251407

Ingredient ID: NPC250696

Ingredient ID: NPC250046

Ingredient ID: NPC249983

Ingredient ID: NPC249471

Ingredient ID: NPC249375

Ingredient ID: NPC248222

Ingredient ID: NPC247312

Ingredient ID: NPC244940

Ingredient ID: NPC242262

Ingredient ID: NPC241909

Ingredient ID: NPC241278

Ingredient ID: NPC237549

Ingredient ID: NPC233806

Ingredient ID: NPC233196

Ingredient ID: NPC228204

Ingredient ID: NPC221482

Ingredient ID: NPC213832

Ingredient ID: NPC213552

Ingredient ID: NPC213285

Ingredient ID: NPC208380

Ingredient ID: NPC205522

Ingredient ID: NPC201773

Ingredient ID: NPC199067

Ingredient ID: NPC198539

Ingredient ID: NPC198455

Ingredient ID: NPC195727

Ingredient ID: NPC189224

Ingredient ID: NPC187861

Ingredient ID: NPC186708

Ingredient ID: NPC183542

Ingredient ID: NPC18074

Ingredient ID: NPC179215

Ingredient ID: NPC178177

Ingredient ID: NPC175580

Ingredient ID: NPC16712

Ingredient ID: NPC165260

Ingredient ID: NPC163699

Ingredient ID: NPC160951

Ingredient ID: NPC15917

Ingredient ID: NPC158333

Ingredient ID: NPC156913

Ingredient ID: NPC154819

Ingredient ID: NPC14958

Ingredient ID: NPC14319

Ingredient ID: NPC136923

Ingredient ID: NPC131698

Ingredient ID: NPC129854

Ingredient ID: NPC127857

Ingredient ID: NPC124578

Ingredient ID: NPC121712

Ingredient ID: NPC1173

Ingredient ID: NPC114410

Ingredient ID: NPC112523

Ingredient ID: NPC112216

Ingredient ID: NPC110676

Ingredient ID: NPC10776

Ingredient ID: NPC104863

Ingredient ID: NPC101043

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Therapeutic Target Lyase CA9 Carbonic anhydrase IX Q16790 CHEMBL3594
Therapeutic Target Lyase CA6 Carbonic anhydrase VI P23280 CHEMBL3025
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Lyase CA5A Carbonic anhydrase VA P35218 CHEMBL4789
Therapeutic Target Lyase CA14 Carbonic anhydrase XIV Q9ULX7 CHEMBL3510
Therapeutic Target Lyase CA5B Carbonic anhydrase VB Q9Y2D0 CHEMBL3969
Therapeutic Target Protein Kinase AURKB Serine/threonine-protein kinase Aurora-B Q96GD4 CHEMBL2185
Therapeutic Target Protein Kinase KDR Vascular endothelial growth factor receptor 2 P35968 CHEMBL279
Therapeutic Target Surface antigen F3 Coagulation factor III P13726 CHEMBL4081
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 AURKA,CA9,KDR,F3,CA6,AURKB,CA14
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 F3,CA5A,AURKA,KDR,AURKB,CA9
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CYP1B1,CA14,CA7,AURKA,AURKB,CA9
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 AURKA,AURKB,CA9,AURKA,AURKB,CA9
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA7,CA5A,AURKA,AURKB,CA9,CA6
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA6,CA14,KDR,AURKA,CA9
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 F3,AURKA,AURKB,CA5B,CA9
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA7,AURKA,AURKB,CA9,CA6
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA7,KDR,AURKA,AURKB,CA9
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 AURKA,AURKB,CA9,CYP1A1,CA6
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CA7,AURKA,AURKB,CA5B,CA9
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CA14,CA7,AURKB,CA9
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 AURKB,CA9,AURKB,CA9
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 AURKA,AURKB,CYP1A2,CA9
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CYP1B1,CA5A,CA9,CA6
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 AURKA,CYP1A2,AURKB,CYP1A1
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 KDR,AURKB,AURKA
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 AURKA,CYP1A2,CA9
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 AURKA,AURKB,CA5B
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 AURKA,AURKB,CA6
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 AURKA,AURKB,CA9
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CA9,CYP1A1,CA6
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 AURKA,AURKB,CA9
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 AURKA,AURKB,CA9
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CYP1B1,KDR,CA9
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 AURKA,KDR
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 AURKA,AURKB
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 AURKA,AURKB
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA14,CA6
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 AURKB,AURKA
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 AURKA,KDR
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 KDR,CA9
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 CA14,F3
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 AURKA,AURKB
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CA14,CYP1A1
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CA9,CYP1A1
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 F3,CYP1A1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CYP1B1,CA7
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 F3,CA5A
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA14,KDR
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1,CA5B
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 KDR
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 KDR
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 KDR
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 KDR
Pleomorphic sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B54
 KDR
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F3
Gastrointestinal stromal tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5B
 KDR
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA6
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 KDR
Thyroid cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10
 KDR
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 KDR
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 KDR
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 KDR
Inborn metabolism deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5C59
 CA14
Acute respiratory distress syndrome
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB00
 F3
Digestive organ benign neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E92
 KDR
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 KDR
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 KDR
Metastatic lymph node neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60
 KDR
Non-small cell lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 KDR
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 KDR
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 F3
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 KDR
Malignant digestive organ neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C11
 KDR
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 KDR
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 CA9
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 CA14
Dengue fever, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D2Z
 AURKB
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Keratoconus
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A78.50
 CA6
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group