• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Strychnos Tabascana


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCTCCACACGCCCACTCGGGCCGTGCGAGGGGGACGGACAGTGGCCTTCCGTGCTTTCTCGCGGTTGGCCCAAATGAGAGTCCCTCCCGACGGGCGTCACGACAAGTGGTGGTTGAATCCCTCAACTAGCGTAGATGTCGTGTCGGAACCCGTTGCCGGAGCGGACTGCCCCGACCCTAACGGCGAGCGTCTCGACGACTCTCGGCCACGACC
Taxonomic Information

Plant ID: NPO29175
Plant Latin Name: Strychnos Tabascana
Taxonomy Genus: Strychnos
Taxonomy Family: Loganiaceae

Plant External Links:

NCBI TaxonomyDB: 1040932
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

44 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC80302

Ingredient ID: NPC76662

Ingredient ID: NPC75384

Ingredient ID: NPC73219

Ingredient ID: NPC6913

Ingredient ID: NPC50880

Ingredient ID: NPC46335

Ingredient ID: NPC38343

Ingredient ID: NPC33338

Ingredient ID: NPC310342

Ingredient ID: NPC305307

Ingredient ID: NPC302857

Ingredient ID: NPC294558

Ingredient ID: NPC286956

Ingredient ID: NPC282812

Ingredient ID: NPC279406

Ingredient ID: NPC278906

Ingredient ID: NPC277510

Ingredient ID: NPC272552

Ingredient ID: NPC264084

Ingredient ID: NPC261324

Ingredient ID: NPC256849

Ingredient ID: NPC255246

Ingredient ID: NPC236202

Ingredient ID: NPC234222

Ingredient ID: NPC227491

Ingredient ID: NPC226315

Ingredient ID: NPC226108

Ingredient ID: NPC224161

Ingredient ID: NPC223548

Ingredient ID: NPC219876

Ingredient ID: NPC195952

Ingredient ID: NPC185392

Ingredient ID: NPC185231

Ingredient ID: NPC157417

Ingredient ID: NPC156654

Ingredient ID: NPC139940

Ingredient ID: NPC136014

Ingredient ID: NPC129800

Ingredient ID: NPC126029

Ingredient ID: NPC119133

Ingredient ID: NPC118284

Ingredient ID: NPC11016

Ingredient ID: NPC108811