• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Origanum Vulgare


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GCGGAAGGATCATTGTCGAACCTTTAAAAGTAGACCGCGAACACGTGTTTAACATCATGGGGGACGGTGCGGGGGCAACCCTCTGCCGTAACCCATCTCCTGCGGGCGTGTATCTTCGGGTCACGTCTTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAAACGAAGCGTTTCCCCCCAGCATCCCGTCCGCGGACGTGTTGGGGGATCGAACGTCTATCAAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTTCCCCGCGCTCAAAGCCGGGTGTTAGGGGGCGACATTGGCCTCCCGTGTACTTCGGTGTGCGGCTGGCCCAAATGCGATCCCCGGGCGACTAGCGTCACGACAAGTGGTGGTTGAACATCTCAATCTCTCTCGTAGTCGTGCAGCTGTGTCGTCATTACGGGCACAATCACAAATGACCCAACGGTGTCGGTGCGTAACTGCACCCCATCTTCGACCGCGACCCCAGGT

Click for details-----ITS1

GCGGAAGGATCATTGTCGAACCTTTAAAAGTAGACCGCGAACACGTGTTTAACATCATGGGGGACGGTGCGGGGGCAACCCTCTGCCGTAACCCATCTCCTGCGGGCGTGTATCTTCGGGTCACGTCTTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAAACGAAGCGTTTCCCCCCAGCATCCCGTCCGCGGACGTGTTGGGGGATCGAACGTCTATCAAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCTTCCCCGCGCTCAAAGCCGGGTGTTAGGGGGCGGACATTGGCCTCCCGTGTACTTCGGTGTGCGGCTGGCCAAAATGCGATCCCCGGGCAACTAGCGTCACAACAAGTGGTGGTTGAACATCTCAATCTCTCTCGTAGTCGTGCAGCTGTGTCGTCATTACGGGCACAATCACAAATGACCCAACGGTGTCGGTGCGTAACTGCACCCCATCTTCGACC
Taxonomic Information

Plant ID: NPO29169
Plant Latin Name: Origanum Vulgare
Taxonomy Genus: Origanum
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 39352
Plant-of-the-World-Online: 453395-1

Used in Medicines

Country/Region:
Brazil; Turkey; Albania; Italy; Turkmenistan; India; Lithuania; China; Chile; Argentina; Spain; Bulgaria

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda


Medicinal Functions:

Antirheumatic; Antiseptic; Antispasmodic; Aromatherapy; Carminative; Cholagogue; Diaphoretic; Emmenagogue; Expectorant; Odontalgic; Parasiticide; Stimulant; Stomachic; Tonic

Geographical Distribution

Brazil; Afghanistan; Italy; Turkmenistan; Canada; Nepal; Lithuania; France; Ireland; Argentina; Norway; Belarus; Iran; Algeria; Turkey; Venezuela; China; Chile; Belgium; Germany; Iraq; Kazakhstan; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Morocco; Sweden; Switzerland; New Zealand; Russia; Bulgaria; Pakistan; Romania; Albania; Portugal; Mexico; Tunisia; Tajikistan; India; United Kingdom; Austria; Greece; Hungary; Taiwan; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

164 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


115 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

99 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC90232

Ingredient ID: NPC88566

Ingredient ID: NPC88278

Ingredient ID: NPC87828

Ingredient ID: NPC86412

Ingredient ID: NPC85813

Ingredient ID: NPC84868

Ingredient ID: NPC82648

Ingredient ID: NPC81010

Ingredient ID: NPC7934

Ingredient ID: NPC78551

Ingredient ID: NPC77249

Ingredient ID: NPC7314

Ingredient ID: NPC72442

Ingredient ID: NPC72285

Ingredient ID: NPC70847

Ingredient ID: NPC64176

Ingredient ID: NPC62045

Ingredient ID: NPC61

Ingredient ID: NPC60288

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC58843

Ingredient ID: NPC55412

Ingredient ID: NPC55372

Ingredient ID: NPC51700

Ingredient ID: NPC51248

Ingredient ID: NPC50992

Ingredient ID: NPC50898

Ingredient ID: NPC50331

Ingredient ID: NPC49151

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489986

Ingredient ID: NPC489907

Ingredient ID: NPC489886

Ingredient ID: NPC48623

Ingredient ID: NPC47946

Ingredient ID: NPC42403

Ingredient ID: NPC39068

Ingredient ID: NPC3824

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC312132

Ingredient ID: NPC309587

Ingredient ID: NPC305835

Ingredient ID: NPC299856

Ingredient ID: NPC29710

Ingredient ID: NPC297081

Ingredient ID: NPC297006

Ingredient ID: NPC296337

Ingredient ID: NPC295777

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC289366

Ingredient ID: NPC287331

Ingredient ID: NPC286774

Ingredient ID: NPC286748

Ingredient ID: NPC285294

Ingredient ID: NPC281686

Ingredient ID: NPC279865

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC277917

Ingredient ID: NPC272614

Ingredient ID: NPC271445

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26974

Ingredient ID: NPC26906

Ingredient ID: NPC2660

Ingredient ID: NPC265305

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC261080

Ingredient ID: NPC259512

Ingredient ID: NPC255042

Ingredient ID: NPC254156

Ingredient ID: NPC252539

Ingredient ID: NPC249815

Ingredient ID: NPC249009

Ingredient ID: NPC246165

Ingredient ID: NPC24506

Ingredient ID: NPC24327

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC237048

Ingredient ID: NPC236315

Ingredient ID: NPC235251

Ingredient ID: NPC233533

Ingredient ID: NPC229262

Ingredient ID: NPC227986

Ingredient ID: NPC226453

Ingredient ID: NPC225710

Ingredient ID: NPC223455

Ingredient ID: NPC221733

Ingredient ID: NPC216127

Ingredient ID: NPC216092

Ingredient ID: NPC215632

Ingredient ID: NPC213749

Ingredient ID: NPC208793

Ingredient ID: NPC207742

Ingredient ID: NPC20461

Ingredient ID: NPC203468

Ingredient ID: NPC202189

Ingredient ID: NPC201844

Ingredient ID: NPC198658

Ingredient ID: NPC193454

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC182840

Ingredient ID: NPC180871

Ingredient ID: NPC178638

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC176017

Ingredient ID: NPC175987

Ingredient ID: NPC174246

Ingredient ID: NPC173996

Ingredient ID: NPC169020

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC166107

Ingredient ID: NPC161316

Ingredient ID: NPC15912

Ingredient ID: NPC156654

Ingredient ID: NPC154480

Ingredient ID: NPC153958

Ingredient ID: NPC152451

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC147983

Ingredient ID: NPC144023

Ingredient ID: NPC14388

Ingredient ID: NPC141078

Ingredient ID: NPC138572

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC136996

Ingredient ID: NPC136014

Ingredient ID: NPC134523

Ingredient ID: NPC130683

Ingredient ID: NPC128863

Ingredient ID: NPC126681

Ingredient ID: NPC126191

Ingredient ID: NPC124161

Ingredient ID: NPC122962

Ingredient ID: NPC120926

Ingredient ID: NPC11433

Ingredient ID: NPC113910

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC110789

Ingredient ID: NPC105246