• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Carya Tonkinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGATACCTGCCCAGCAGAACGACCCGTGAACTCGTAACAGCCTTCTGGGTTGGGGTGTCATGCCCCCTCCCAAAAACGGTTGGGAGGGCACGTTGAAAGCTGCCCACCACTCCTCACGTGCGGCGGGTCAGTCTTCTCGTTCCCTTCCCAGCCGAACAATGAACCCCGGCGCGGTCTGCGCCAAGGAACTTAAACAAGGAGTAACCACGGCCGCCCCGGAAACGGTGTGCGTGCCGTTGGTGACATCTTACCATGATACATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO29145
Plant Latin Name: Carya Tonkinensis
Taxonomy Genus: Carya
Taxonomy Family: Juglandaceae

Plant External Links:

NCBI TaxonomyDB: 139930
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

14 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


0 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC61152

Ingredient ID: NPC54308

Ingredient ID: NPC304720

Ingredient ID: NPC275913

Ingredient ID: NPC27498

Ingredient ID: NPC260844

Ingredient ID: NPC222423

Ingredient ID: NPC184544

Ingredient ID: NPC154995

Ingredient ID: NPC130625

Ingredient ID: NPC119094

Ingredient ID: NPC113836

Ingredient ID: NPC108476

Ingredient ID: NPC104222