CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Ormosia Fordiana

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTCGCGAGCAGTGCGACCCGTGAATTTGTTTCTACTACTACCCAGGGGCGGCTCGCGGCGCTCAGACGCCTCGGCCCCTCGCGTCGGGAGGCGCCCCCGCCTGGCGCGGCCTCCTCCCGGCCGAACAATAAAAACCCCGGCGCCGAACGCGCCAAGGAACCCCGAAATCGTTCGGTGCGCCCCCCGTCGACCCGGAGACGGTGCTCGTGGGGGTGGCGCTGCGACGCGCGAAGATGCAAAATGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCACATCGTTGCCCCATCGCCGGAGCCTCGTGCTAGGCGCCGAGCGGGGGCGAGCGTTGGCTTCCCGTGAGCATCGGCTCGCGGTTGGTTGAAAATCGGGTCCGCGGCGGAGTGCGCCGCGACGGAGGGTGGTTGAGTAACAGCTCGAGACCGGCCGCGCGCGTCTCTCCGCCTGCTCCGGGACTCTGTGACCCACGAGCGTCGATCGATCGCCCATG

Click for details-----ITS1

Click for details-----ITS2

ATCGTTGCCCCATCGCCGGAGCCTCGTGCTAGGCGCCGAGCGGGGGCGAGCGTTGGCTTCCCGTGAGCATCGGCTCGCGGTTGGTTGAAAATCGGGTCCGCGGCGGAGTGCGCCGCGACGGAGGGTGGTTGAGTAACAGCTCGAGACCGGCCGCGCGCGTCTCTCCGCCTGCTCCGGGACTCTGTGACCCACGAGCGTCGATCGATCGCCCATGACGG

Taxonomic Information

Plant ID: NPO29144
Plant Latin Name: Ormosia Fordiana
Taxonomy Genus: Ormosia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1009498
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

31 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

31 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

18 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC76145

Ingredient ID: NPC69712

Ingredient ID: NPC68889

Ingredient ID: NPC67508

Ingredient ID: NPC66272

Ingredient ID: NPC60186

Ingredient ID: NPC54145

Ingredient ID: NPC312904

Ingredient ID: NPC310907

Ingredient ID: NPC310210

Ingredient ID: NPC306843

Ingredient ID: NPC289653

Ingredient ID: NPC285267

Ingredient ID: NPC26240

Ingredient ID: NPC240308

Ingredient ID: NPC237408

Ingredient ID: NPC222154

Ingredient ID: NPC221467

Ingredient ID: NPC22098

Ingredient ID: NPC218742

Ingredient ID: NPC214584

Ingredient ID: NPC212794

Ingredient ID: NPC210560

Ingredient ID: NPC205421

Ingredient ID: NPC192135

Ingredient ID: NPC168683

Ingredient ID: NPC154847

Ingredient ID: NPC136508

Ingredient ID: NPC12319

Ingredient ID: NPC114526

Ingredient ID: NPC111888

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR7	Serotonin 7 (5-HT7) receptor	P34969	CHEMBL3155
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR2B	Serotonin 2b (5-HT2b) receptor	P41595	CHEMBL1833
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR6	Serotonin 6 (5-HT6) receptor	P50406	CHEMBL3371
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1A	Serotonin 1a (5-HT1a) receptor	P08908	CHEMBL214
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR5A	Serotonin 5a (5-HT5a) receptor	P47898	CHEMBL3426
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	2

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04392622	d-Limonene +Radiation +Platinum Based Chemo for Xerostomia Prevention in Locally Advanced Head and Neck Squamous Cell Carcinoma	xerostomia	Limonene (NPC76145)	NP level
NCT04853082	Limonene on Regulating Metabolism-related Fatty Liver Disease (MAFLD) and Analysis of TCM Constitution	Hepatic steatosis	Limonene (NPC76145)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	HTR7,HTR1A,DRD1,HTR6
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	HTR1A,HTR7,DRD1,HTR6
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	HTR6,HTR7,HTR1A,HTR5A
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	DRD1,LMNA,HTR7,HTR2B
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD1,HTR2B,HTR1A
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	HTR6,HTR7,HTR1A
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	HTR1A,HTR2B,HTR7
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	HTR7,HTR1A,HTR2B
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	HTR2B,HTR1A,DRD1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	HTR6,HTR7,HTR1A
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	DRD1,LMNA,HTR7
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	DRD1,HTR7,HTR5A
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	HTR2B,HTR5A
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	HTR1A HTR7
Bipolar disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60	HTR7,HTR1A
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	HTR6,HTR1A
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	DRD1,HTR1A
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HTR6,HTR7
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A3,HTR6
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CSNK2A3,LMNA
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	LMNA,HTR2B
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	HTR6,HTR7
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	HTR6,HTR7
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CSNK2A3,LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	HTR6,HTR2B
Hypoactive sexual desire dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00	HTR1A
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	HTR1A
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Skin/mucosal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD27	HTR1A
Ejaculatory dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA03	HTR1A
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD1
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	HTR1A
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	HTR1A
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Dissociative neurological symptom disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B60	HTR6
Social anxiety disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B04	HTR1A
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	HTR1A
Sexual dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00-HA01	HTR1A
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	HTR1A
Bulimia nervosa Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B81	HTR1A
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	HTR1A
Coronary atherosclerosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA80	HTR1A
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	CSNK2A1
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	HTR1A
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	HTR6
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CSNK2A1
Juvenile idiopathic arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA24	HTR1A
Neurodegenerative disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20-8A23	HTR6
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	HTR1A
Other specified non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92.Y	NCT04853082
Xerostomia Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA02.1	NCT04392622
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	HTR7
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	DRD1
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	HTR7
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	HTR7
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	HTR2B
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	HTR6
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	DRD1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	HTR5A

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Ormosia Fordiana

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

31 All known Ingredients in Total

31 Ingredients with Acceptable Bioavailablity

18 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Schizophrenia

Parkinsonism

Pheochromocytoma

Adenocarcinoma of pancreas

Psychotic disorder

Mild neurocognitive disorder

Depression

Attention deficit hyperactivity disorder

Pulmonary hypertension

Alzheimer disease

Mesothelioma of pleura

Malignant neoplasms of thymus

Pituitary gland disorder

Psoriasis

Bipolar disorder

Anxiety

Dementia

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Malignant neoplasms of biliary tract, distal bile duct

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Cytomegaloviral disease

Glioblastoma of brain

Carpal tunnel syndrome

Hypoactive sexual desire dysfunction

Insomnia

Coronavirus infection

Skin/mucosal anomaly

Ejaculatory dysfunction

Cocaine use disorder

Allergic/hypersensitivity disorder

Abortion

Postoperative inflammation

Migraine

Tic disorder

Dissociative neurological symptom disorder

Social anxiety disorder

Intellectual development disorder

Sexual dysfunction

Malignant haematopoietic neoplasm

Bulimia nervosa

Tonus and reflex abnormality

Coronary atherosclerosis

Liver cancer

Muscular atrophy

Obesity

Solid tumour/cancer

Juvenile idiopathic arthritis

Neurodegenerative disorder

Mood disorder

Other specified non-alcoholic fatty liver disease

Xerostomia

Leishmaniasis

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Superficial ovarian endometriosis

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Germ cell tumour of testis

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations