• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Euonymus Alatus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAGAGCAGAACGACCCGCGAACAAGTGAAAAACATCACGGGCGGCAGGCCTCCGGGCCGGTCGCTCGTAGTCCGGGAGCATGGACGTGGGAAGCCACAGCCACTGCTCCATGGGCACAAAAAACGAACCCCGGCGCAGATTGCGCCAAGGAACCAAAAAAAGATGTGCGCTCCCCCCGTCCCGGAGACGGTGCTGCGAGGGGATGCGTCGTCGTTGATATCAAATATGAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACAACGTCGCCAACCCACCCCCCTGTGGGGACGGTGTGGGATGGCGGATATTGGCCTCCCGTGCGCTCCCGCTCGCGGTTGGCCTAAAACATAGCCCCTTGGCGATGGCAGCCACGGCACGCGGTGGTCGAAAGCGCTAGCTCCTCGGAAACCGCCGTGGCGAGCCTCGTCGACGTGGAGCCAAAGACCCCGACGCGAGCGTCCTCACAAAGCGACCCCA

Click for details-----ITS1

TCGAAACCTGCAGAGCAGAACGACCCGCGAACAAGTGAGAACAACCACGGGAGTCCGGCCTCCGGGTCGGTCGCTCGTAGCCCGGGAGCGGGGATGTGGGAAGCCACAGCCCTTGCGCCCCGGGCACAACAAACGAACCCCGGCGCAGATCGCGCCAAGGAACCAAAAAAAGGATGTGCGCTCCCCCCGTCCCGGAAACGGTGCCGCGTGGGGACGCGTCGTCGTTGATATCAAATACAAAA

Click for details-----ITS2

AACGTCGCCACCCCACCCCCCACGGGGACTGCGTGGGATGGCGGATATTGGCCTCCCGTGCGCTCCCGCTCGCGGTTGGCCCAAAACACGGCCCCTTGGCTACGGCAGCCACGGCACGCGGTGGTCGAAAGCTCTAGCTCCTCGGAAACCGCCGTGGCGAGCCTCGTCGAAGTGGAGCCACAGACCCCGACGCTAGCGTCATCACA
Taxonomic Information

Plant ID: NPO29118
Plant Latin Name: Euonymus Alatus
Taxonomy Genus: Euonymus
Taxonomy Family: Celastraceae

Plant External Links:

NCBI TaxonomyDB: 4307
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM


Medicinal Functions:

Anodyne; Anthelmintic; Antiphlogistic; Antipruritic; Astringent; Blood tonic; Cancer; Carminative; Emmenagogue; Hypoglycaemic

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

98 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


66 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

62 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98680

Ingredient ID: NPC95615

Ingredient ID: NPC92507

Ingredient ID: NPC87725

Ingredient ID: NPC84810

Ingredient ID: NPC82920

Ingredient ID: NPC81186

Ingredient ID: NPC79943

Ingredient ID: NPC7903

Ingredient ID: NPC63118

Ingredient ID: NPC6300

Ingredient ID: NPC62765

Ingredient ID: NPC62290

Ingredient ID: NPC61477

Ingredient ID: NPC52686

Ingredient ID: NPC50898

Ingredient ID: NPC470098

Ingredient ID: NPC470097

Ingredient ID: NPC470096

Ingredient ID: NPC470095

Ingredient ID: NPC3862

Ingredient ID: NPC35208

Ingredient ID: NPC35069

Ingredient ID: NPC32441

Ingredient ID: NPC314267

Ingredient ID: NPC311485

Ingredient ID: NPC310604

Ingredient ID: NPC305186

Ingredient ID: NPC300166

Ingredient ID: NPC29883

Ingredient ID: NPC297815

Ingredient ID: NPC295992

Ingredient ID: NPC294902

Ingredient ID: NPC292056

Ingredient ID: NPC290791

Ingredient ID: NPC289660

Ingredient ID: NPC287657

Ingredient ID: NPC283217

Ingredient ID: NPC277924

Ingredient ID: NPC277493

Ingredient ID: NPC277400

Ingredient ID: NPC275463

Ingredient ID: NPC274613

Ingredient ID: NPC266441

Ingredient ID: NPC265800

Ingredient ID: NPC263367

Ingredient ID: NPC263261

Ingredient ID: NPC263124

Ingredient ID: NPC26065

Ingredient ID: NPC260397

Ingredient ID: NPC256853

Ingredient ID: NPC250486

Ingredient ID: NPC24490

Ingredient ID: NPC243728

Ingredient ID: NPC239128

Ingredient ID: NPC237727

Ingredient ID: NPC237031

Ingredient ID: NPC227017

Ingredient ID: NPC219876

Ingredient ID: NPC209360

Ingredient ID: NPC20791

Ingredient ID: NPC199914

Ingredient ID: NPC192638

Ingredient ID: NPC192065

Ingredient ID: NPC187107

Ingredient ID: NPC184447

Ingredient ID: NPC184248

Ingredient ID: NPC183181

Ingredient ID: NPC182570

Ingredient ID: NPC180261

Ingredient ID: NPC1788

Ingredient ID: NPC17879

Ingredient ID: NPC1786

Ingredient ID: NPC176740

Ingredient ID: NPC165172

Ingredient ID: NPC164697

Ingredient ID: NPC162806

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC156502

Ingredient ID: NPC156353

Ingredient ID: NPC153783

Ingredient ID: NPC147821

Ingredient ID: NPC145134

Ingredient ID: NPC141765

Ingredient ID: NPC137419

Ingredient ID: NPC133990

Ingredient ID: NPC12640

Ingredient ID: NPC122212

Ingredient ID: NPC116775

Ingredient ID: NPC111888

Ingredient ID: NPC111247

Ingredient ID: NPC111201

Ingredient ID: NPC110899

Ingredient ID: NPC108831

Ingredient ID: NPC1075

Ingredient ID: NPC10737

Ingredient ID: NPC1037