• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Tsuga Mertensiana


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ACAATATACGCCCTCTCTGCACGGTAGCGGGGAGGAGCGGAAATGGTCGTCCGTGCCCAACGCGGTGCGGTTGGCTGAAATGCATTCGATGTTGTGCGCTTTGCATCGGCCAGCGGTGGCCTTGTCCCCCCTTTGGTTGCGGGCGAGTCTGCGTTTGCCCATGCTAGGTGTGCCCGACGTCGTATGAACTTTGTTTGGGCACTATC
Taxonomic Information

Plant ID: NPO29046
Plant Latin Name: Tsuga Mertensiana
Taxonomy Genus: Tsuga
Taxonomy Family: Pinaceae

Plant External Links:

NCBI TaxonomyDB: 93696
Plant-of-the-World-Online: 264014-1

Used in Medicines

Unknown.

Geographical Distribution

Canada; United States

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

29 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98185

Ingredient ID: NPC89904

Ingredient ID: NPC87322

Ingredient ID: NPC6278

Ingredient ID: NPC57315

Ingredient ID: NPC34864

Ingredient ID: NPC3460

Ingredient ID: NPC32643

Ingredient ID: NPC311485

Ingredient ID: NPC289774

Ingredient ID: NPC284512

Ingredient ID: NPC282435

Ingredient ID: NPC262182

Ingredient ID: NPC254124

Ingredient ID: NPC228383

Ingredient ID: NPC226250

Ingredient ID: NPC209846

Ingredient ID: NPC20791

Ingredient ID: NPC16841

Ingredient ID: NPC162261

Ingredient ID: NPC161571

Ingredient ID: NPC158654

Ingredient ID: NPC156461

Ingredient ID: NPC155144

Ingredient ID: NPC153320

Ingredient ID: NPC1306

Ingredient ID: NPC126200

Ingredient ID: NPC120464

Ingredient ID: NPC110110