• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Scutellaria Orientalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TTGTCGAAACCTGCGAAAGCAGACCGCGAACACGTGTCTAACGACCAAACGAGGGCAACGGCGAGGGGGCGTGCCCCCCGTCGGGGTCCTCACACCCGTGCGGCCGGTGCCAAGGCACCGCGCCGCGCGGGCCAACGAACCCGGGCGCGGAACGCGCCAAGGAAAACTAAAAGAGAGCGTCCCCCCCACCGTGCGTCCCGTCCGCGGAGCACGCCCGGGGTGGGTCGGGCGTCCATCGAATGTCATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO29041
Plant Latin Name: Scutellaria Orientalis
Taxonomy Genus: Scutellaria
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 53170
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey

Traditional Medicine System:

Geographical Distribution

Turkey

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

20 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96989

Ingredient ID: NPC63774

Ingredient ID: NPC63724

Ingredient ID: NPC49168

Ingredient ID: NPC311113

Ingredient ID: NPC307580

Ingredient ID: NPC299164

Ingredient ID: NPC267119

Ingredient ID: NPC257191

Ingredient ID: NPC254509

Ingredient ID: NPC251770

Ingredient ID: NPC235260

Ingredient ID: NPC2261

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC173637

Ingredient ID: NPC14974

Ingredient ID: NPC121744

Ingredient ID: NPC107704

Ingredient ID: NPC101853