• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Zanthoxylum Americanum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTCTGCAAGAGCAGAACGACCCGTGAACTCGTGATAACAATCGCGGGGGGCGCGCTTCACGGCCGCTCCCCCACATCTCCGTGGGTGCGGGACTCGTCCCGTTCCCCGCGGGGGTGAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGAGGCCCCGGACACGGTGTGCTCCGGGATGCGGCGCCTTCTTTCACTCTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCACCCCTCCCCCACCCCGGGGGCATGGCGGTGCGGGCGGATAATGGCCTCCCGTGCGCTCCCCGCTCGCGGCTGGCCCAAATTTGAGTCCCCGGCGACCAGAGCCGCGGCGATCGGTGGTGAATACAAACCTCTCGAGCCAACGTCGCGTGTTTGGCCCTCCATTCCGGGACTCAGGGACCCTATTGCTCTGCGCAAGCAGCGCTCGCATC

Click for details-----ITS1

TCGAAACCTCTGCAAGAGCAGAACGACCCGTGAACTCGTGATAACAATCGCGGGGGGCGCGCTTCACGGCCGCTCCCCCACATCTCCGTGGGTGCGGGACTCGTCCCGTTCCCCGCGGGGGTGAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGAGGCCCCGGACACGGTGTGCTCCGGGATGCGGCGCCTTCTTTCACTCTATCTATAA

Click for details-----ITS2

ATCGTTGCCCCACCCCTCCCCCACCCCGGGGGCATGGCGGTGCGGGCGGATAATGGCCTCCCGTGCGCTCCCCGCTCGCGGCTGGCCCAAATTTGAGTCCCCGGCGACCAGAGCCGCGGCGATCGGTGGTGAATACAAACCTCTCGAGCCAACGTCGCGTGTTTGGCCCTCCATTCCGGGACTCAGGGACCCTATTGCTCTGCGCAAGCAGCGCTCGCATC
Taxonomic Information

Plant ID: NPO29030
Plant Latin Name: Zanthoxylum Americanum
Taxonomy Genus: Zanthoxylum
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 354526
Plant-of-the-World-Online: 775568-1

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
TCM


Medicinal Functions:

Anodyne; Antirheumatic; Antispasmodic; Carminative; Diaphoretic; Diuretic; Irritant; Odontalgic; Sialagogue; Skin; Stimulant

Geographical Distribution

United States; India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

21 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC8158

Ingredient ID: NPC61152

Ingredient ID: NPC54308

Ingredient ID: NPC304720

Ingredient ID: NPC290605

Ingredient ID: NPC275913

Ingredient ID: NPC27498

Ingredient ID: NPC273225

Ingredient ID: NPC271215

Ingredient ID: NPC260844

Ingredient ID: NPC257188

Ingredient ID: NPC250653

Ingredient ID: NPC222423

Ingredient ID: NPC185541

Ingredient ID: NPC184544

Ingredient ID: NPC154995

Ingredient ID: NPC154176

Ingredient ID: NPC130625

Ingredient ID: NPC119094

Ingredient ID: NPC113836

Ingredient ID: NPC104222