CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Zanthoxylum Americanum

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTCTGCAAGAGCAGAACGACCCGTGAACTCGTGATAACAATCGCGGGGGGCGCGCTTCACGGCCGCTCCCCCACATCTCCGTGGGTGCGGGACTCGTCCCGTTCCCCGCGGGGGTGAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGAGGCCCCGGACACGGTGTGCTCCGGGATGCGGCGCCTTCTTTCACTCTATCTATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCACCCCTCCCCCACCCCGGGGGCATGGCGGTGCGGGCGGATAATGGCCTCCCGTGCGCTCCCCGCTCGCGGCTGGCCCAAATTTGAGTCCCCGGCGACCAGAGCCGCGGCGATCGGTGGTGAATACAAACCTCTCGAGCCAACGTCGCGTGTTTGGCCCTCCATTCCGGGACTCAGGGACCCTATTGCTCTGCGCAAGCAGCGCTCGCATC

Click for details-----ITS1

Click for details-----ITS2

ATCGTTGCCCCACCCCTCCCCCACCCCGGGGGCATGGCGGTGCGGGCGGATAATGGCCTCCCGTGCGCTCCCCGCTCGCGGCTGGCCCAAATTTGAGTCCCCGGCGACCAGAGCCGCGGCGATCGGTGGTGAATACAAACCTCTCGAGCCAACGTCGCGTGTTTGGCCCTCCATTCCGGGACTCAGGGACCCTATTGCTCTGCGCAAGCAGCGCTCGCATC

Taxonomic Information

Plant ID: NPO29030
Plant Latin Name: Zanthoxylum Americanum
Taxonomy Genus: Zanthoxylum
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 354526
Plant-of-the-World-Online: 775568-1

Used in Medicines

Country/Region:

China; India

Traditional Medicine System:

TCM

Medicinal Functions:

Anodyne; Antirheumatic; Antispasmodic; Carminative; Diaphoretic; Diuretic; Irritant; Odontalgic; Sialagogue; Skin; Stimulant

Geographical Distribution

United States; India; China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

21 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC8158

Ingredient ID: NPC61152

Ingredient ID: NPC54308

Ingredient ID: NPC304720

Ingredient ID: NPC290605

Ingredient ID: NPC275913

Ingredient ID: NPC27498

Ingredient ID: NPC273225

Ingredient ID: NPC271215

Ingredient ID: NPC260844

Ingredient ID: NPC257188

Ingredient ID: NPC250653

Ingredient ID: NPC222423

Ingredient ID: NPC185541

Ingredient ID: NPC184544

Ingredient ID: NPC154995

Ingredient ID: NPC154176

Ingredient ID: NPC130625

Ingredient ID: NPC119094

Ingredient ID: NPC113836

Ingredient ID: NPC104222

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Isomerase	TOP1	DNA topoisomerase I	P11387	CHEMBL1781
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Serine protease	F10	Coagulation factor X	P00742	CHEMBL244

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F10,CA9,TOP1,ANTXR2
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA9,CA12,CA9,CA12
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA9,TOP1,CA12
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA12,CA9,TOP1
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	F10,CA12,CA9
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,CA9,TOP1
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA9,CA12,ANTXR2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	F10,CA12,CA9
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	CA9,TOP1
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	TOP1,CA12
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	TOP1,CA9
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA9,TOP1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CA9
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CA9,CA9
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,CA9
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA9,CA12
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA9,CA12
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CA9
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,TOP1
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F10
Blood-forming organ disease Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3C0Z	F10
Venous thromboembolism Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD72	F10
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	TOP1
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	TOP1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	TOP1
Christmas disease Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B11	F10
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	TOP1
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F10
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	F10
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	TOP1
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	TOP1
Supraventricular tachyarrhythmia Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81	F10
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	F10
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F10
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TOP1
Deep vein thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD71	F10
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F10
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TOP1
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	TOP1
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	TOP1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	F10
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CA9
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	CA9
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CA9
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	F10
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA9
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CA9
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA9
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CA9
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	ANTXR2
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	ANTXR2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Zanthoxylum Americanum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

21 All known Ingredients in Total

7 Ingredients with Acceptable Bioavailablity

9 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Hepatocellular carcinoma of liver

Breast cancer

Solid tumour/cancer

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Renal cell carcinoma

Bacterial infection

Mature T-cell lymphoma

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Other specified malignant neoplasms of bronchus or lung

Adenocarcinoma of bronchus or lung

Invasive carcinoma of breast

Germ cell tumour of testis

Bleeding disorder

Blood-forming organ disease

Venous thromboembolism

Stomach cancer

Mature B-cell lymphoma

Lung cancer

Christmas disease

Brain cancer

Coronary thrombosis

Attention deficit hyperactivity disorder

Human immunodeficiency virus disease

Myelodysplastic syndrome

Supraventricular tachyarrhythmia

Cerebral ischaemia

Coagulation defect

Ovarian cancer

Deep vein thrombosis

Thrombosis

Seborrhoeic dermatitis

Esophageal cancer

Gastrointestinal stromal tumour

Colorectal cancer

Pheochromocytoma

Osteoarthritis, unspecified

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Other specified malignant neoplasms ofcolon

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Chronic rhinosinusitis

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of thymus

Renal cell carcinoma, chromophobe type

Carpal tunnel syndrome

Gliomas of brain

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities