• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cicer Cuneatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGATGCCTTACATGCAGTCCAACACGTGAATCAGTTTGAACACACAGGGTTGGGTTGAGGTGTTGAACGCCTCGGCCTAACTCCGGTTCAGAGGTGGACACCCCGCGTGTCCTCCTCTGTGCCAAAACTCAAACCCCGACGCTGAATGCGTCAAGGAATTAAAACTTTGTTATGTGCGCGCCTGCACGGAACCGGAGACGGCTTTCGTTCGGGTTGTGTTTTGACACATGAAATAGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO29028
Plant Latin Name: Cicer Cuneatum
Taxonomy Genus: Cicer
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 92720
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

34 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


30 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC89549

Ingredient ID: NPC85932

Ingredient ID: NPC76982

Ingredient ID: NPC7433

Ingredient ID: NPC6786

Ingredient ID: NPC4687

Ingredient ID: NPC3207

Ingredient ID: NPC310211

Ingredient ID: NPC308137

Ingredient ID: NPC303951

Ingredient ID: NPC300991

Ingredient ID: NPC280799

Ingredient ID: NPC269367

Ingredient ID: NPC252251

Ingredient ID: NPC250351

Ingredient ID: NPC249583

Ingredient ID: NPC247803

Ingredient ID: NPC246651

Ingredient ID: NPC23294

Ingredient ID: NPC228273

Ingredient ID: NPC218034

Ingredient ID: NPC210828

Ingredient ID: NPC209174

Ingredient ID: NPC201697

Ingredient ID: NPC199277

Ingredient ID: NPC174760

Ingredient ID: NPC169402

Ingredient ID: NPC161833

Ingredient ID: NPC160381

Ingredient ID: NPC150239

Ingredient ID: NPC141504

Ingredient ID: NPC135887

Ingredient ID: NPC131885

Ingredient ID: NPC116238