• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Brassica Juncea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGTACCCTGGAAACAGAACGACCTGAGAACGATGAAACATCACTCTCGGTAGGCCGGTTTCTTACTGTGCCTGCTGACTTCGTGGTTATGCGTTCATCCTTGGCCAAGACTTCAGTTTTGGTTGGATCGTACGCATAGCTTCCGGATATCACCAAACCCCGGCACGAAAAGTGTCAAGGAAAATGCAACTAAACAGCCTGCTTTCGCCAACCCGGAGACGGTGTTTGTTCGGAAGCAGTGCTGCAATGTAAAGTCTAAAACGACTCTCGGCAACGGATCTCTCGGCTCTCGCATCGATGAGGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAAATCGTCGTCCCCCCATCCTCTCGAGGATATGGGACGGAAGCTGATCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGTCAGGAGCGTCTTGACATGCGGTGGTGAATTCAAGCCTCGTAATATCGTCGGTCGTTCCGGTCCAGAAGCTCTCGATGACCCAAAGTCCTCAACGCGACCCCA

Click for details-----ITS1

TCGTACCCTGGAAACAGAACGACCCGAGAACGATGAAACACCACTCTCGGTGGGCCGGTCTCTTAGCCGATTCCGTGCCTGCCGATTTCCGTGGTTATGTGTTCCGTCCCCGGTTCAAGACTTACTTAGGTCTCGGTCGGATCGTGCGCATAGCTTCCGGATTTCACCAAACCCCGGCACGAAAAGTGTCAAGGAACATGCAACTAAACAGCCTGCTTTCGCCAACCCGGAGACGGTGTTTGCTCGGAAGTAGTGCTGCAATGTAAAGTCTAAAA

Click for details-----ITS2

ATCGTCGTCCCCCCATCCTCTCGAGGATATGGGACGGAAGCTGATCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGTCAGGAGCGTCTTGACATGCGGTGGTGAATTTAATTCTCGTCATATAGTCAGACGTTCCGGTCCAAAAGCTCTTGATGACCCAAAGTCCTCAACGCGACCCCAGGTCAGGCTGATCACTCGAGT
Taxonomic Information

Plant ID: NPO29007
Plant Latin Name: Brassica Juncea
Taxonomy Genus: Brassica
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 3707
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; Philippines; India; Russia

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Anodyne; Antibiotic; Aperient; Diuretic; Emetic; Galactogogue; Rubefacient; Stimulant

Geographical Distribution

India; Philippines; China; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

156 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


121 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

94 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC98086

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93617

Ingredient ID: NPC90968

Ingredient ID: NPC8981

Ingredient ID: NPC89778

Ingredient ID: NPC89042

Ingredient ID: NPC83628

Ingredient ID: NPC80841

Ingredient ID: NPC75611

Ingredient ID: NPC73584

Ingredient ID: NPC7208

Ingredient ID: NPC72033

Ingredient ID: NPC71695

Ingredient ID: NPC6717

Ingredient ID: NPC66775

Ingredient ID: NPC66052

Ingredient ID: NPC6516

Ingredient ID: NPC64663

Ingredient ID: NPC62045

Ingredient ID: NPC61851

Ingredient ID: NPC61477

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC55412

Ingredient ID: NPC490208

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC4812

Ingredient ID: NPC34908

Ingredient ID: NPC328447

Ingredient ID: NPC315296

Ingredient ID: NPC313182

Ingredient ID: NPC313032

Ingredient ID: NPC30691

Ingredient ID: NPC302003

Ingredient ID: NPC299134

Ingredient ID: NPC29601

Ingredient ID: NPC294902

Ingredient ID: NPC293628

Ingredient ID: NPC292988

Ingredient ID: NPC292473

Ingredient ID: NPC29188

Ingredient ID: NPC291473

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC288404

Ingredient ID: NPC287350

Ingredient ID: NPC285322

Ingredient ID: NPC284386

Ingredient ID: NPC281972

Ingredient ID: NPC281686

Ingredient ID: NPC279865

Ingredient ID: NPC27723

Ingredient ID: NPC273330

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC266347

Ingredient ID: NPC264111

Ingredient ID: NPC255607

Ingredient ID: NPC254482

Ingredient ID: NPC251860

Ingredient ID: NPC250406

Ingredient ID: NPC248049

Ingredient ID: NPC245814

Ingredient ID: NPC245346

Ingredient ID: NPC245027

Ingredient ID: NPC244738

Ingredient ID: NPC24327

Ingredient ID: NPC242580

Ingredient ID: NPC240328

Ingredient ID: NPC237812

Ingredient ID: NPC230301

Ingredient ID: NPC226453

Ingredient ID: NPC226265

Ingredient ID: NPC226027

Ingredient ID: NPC225851

Ingredient ID: NPC225710

Ingredient ID: NPC221822

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC217226

Ingredient ID: NPC21290

Ingredient ID: NPC209111

Ingredient ID: NPC208793

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC205093

Ingredient ID: NPC203468

Ingredient ID: NPC203440

Ingredient ID: NPC201844

Ingredient ID: NPC197376

Ingredient ID: NPC196676

Ingredient ID: NPC194857

Ingredient ID: NPC194122

Ingredient ID: NPC193989

Ingredient ID: NPC188867

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC184816

Ingredient ID: NPC179860

Ingredient ID: NPC178607

Ingredient ID: NPC178233

Ingredient ID: NPC17810

Ingredient ID: NPC174246

Ingredient ID: NPC173003

Ingredient ID: NPC172064

Ingredient ID: NPC170739

Ingredient ID: NPC170112

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC163528

Ingredient ID: NPC162620

Ingredient ID: NPC162282

Ingredient ID: NPC159096

Ingredient ID: NPC158404

Ingredient ID: NPC157567

Ingredient ID: NPC15698

Ingredient ID: NPC15658

Ingredient ID: NPC152707

Ingredient ID: NPC152452

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149494

Ingredient ID: NPC149155

Ingredient ID: NPC147983

Ingredient ID: NPC144939

Ingredient ID: NPC138865

Ingredient ID: NPC137958

Ingredient ID: NPC136281

Ingredient ID: NPC136014

Ingredient ID: NPC133836

Ingredient ID: NPC132307

Ingredient ID: NPC130683

Ingredient ID: NPC126925

Ingredient ID: NPC126759

Ingredient ID: NPC126681

Ingredient ID: NPC126250

Ingredient ID: NPC123304

Ingredient ID: NPC122493

Ingredient ID: NPC119090

Ingredient ID: NPC116775

Ingredient ID: NPC116709

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC112889

Ingredient ID: NPC110533

Ingredient ID: NPC10990

Ingredient ID: NPC108860

Ingredient ID: NPC108358

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC107373

Ingredient ID: NPC106551