• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Acer Rubrum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAACGACCCGCGAACCCGTTTTAACATCGGGGGGAGCACCCGTGGTCCCCCCTCTGCAGTCGGATCGATGGCACCCGCCCTCGCTCCCTCGGCACAACAACGAACCCCGGCGCGGACCGCGCCAAGGAAACTTAACGAGAGAGCGCGCCCTTGCCGCCCCGGAGACGGTGTGCGTGCTCGTGGCGTTGCCTTCTTCCATTATTTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTAGGCCGAGGGCACGCCTGCCTGGGTGTCACGCATCGTTGCCCCCTCCCAAACCCCCCTCTCCTCGAAAGGGGACGAGGGGACTTGGCCGTGGGCGGATATTGGCCTCCCGTCTGCCGAATGGCTCGCGGTTGGCCTAAATACGAGTCGTCGGCGACGGACGCCGTGACGTTCGGTGGTCAAAGAAACCTCGAGCTCCCGTCGCGCGTACGTCGTCGGTCCGATAAGGCTCACCGACCCTGAAGCGCTGTGGACACCACGCACC

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTGCCCCCTCCCAAACCCCCCTCTCCTCGAAAGGGGACGAGGGGACTTGGCCGTGGGCGGATATTGGCCTCCCGTCTGCCGAATGGCTCGCGGTTGGCCTAAATACGAGTCGTCGGCGACGGACGCCGTGACGTTCGGTGGTCAAAGAAACCTCGAGCTCCCGTCGCGCGTACGTCGTCGGTCCGATAAGGCTCACCGACCCTGAAGCGCTGTGGACACCACGCACC
Taxonomic Information

Plant ID: NPO28946
Plant Latin Name: Acer Rubrum
Taxonomy Genus: Acer
Taxonomy Family: Sapindaceae

Plant External Links:

NCBI TaxonomyDB: 45314
Plant-of-the-World-Online: 1867-2

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antispasmodic; Astringent; Ophthalmic

Geographical Distribution

Canada; United States; Georgia; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC75763

Ingredient ID: NPC52197

Ingredient ID: NPC299010

Ingredient ID: NPC264317

Ingredient ID: NPC250457

Ingredient ID: NPC226738

Ingredient ID: NPC225710

Ingredient ID: NPC225036

Ingredient ID: NPC22176

Ingredient ID: NPC190587

Ingredient ID: NPC142528

Ingredient ID: NPC12218

Ingredient ID: NPC121573

Ingredient ID: NPC112068

Ingredient ID: NPC110126

Ingredient ID: NPC105525