• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Piper Nigrum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTGACCTGCGGAAGGATCATTGTTGATGCCCATCGAAACAAGACAGACGGAAAGCGAACTTGTGAACCCTGGTGTTCTTTGGCCCGCACGCCGGGCGGCGCTCAGCGCGTGTCGGGCAGCGACGAACCAAATCTCGGCGCAGGACGCGCCAAGCAACTCGGAAGCTTTGATTGCGGCGCCCTCTTCCCTGTCGGGATGGAGGGCGCGCATCGAACACTTACAAGTCAGTACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTTTGGTCGAGGGCACATCTGCTTGGGCGTTAAACAACTCGCCTCCCGCCGCCTTCCCCCTGCAGACTCGAGCGAGGGGCCTGTCGGAGATGAGGGTAGGTGGGACGGAGTCTGGTCGTCCGTGTGCCTGCAGCGCATGCGGTTGGCTGAAAAGCCTGGGCCATGGGCTGCGTGCGGCTCAGCGAGTGGTGGTTGTGCGCCCTCGCAAGGCGGCGTTGTCAGCGCGTTGTGCCGTTCGCTCCCCGATTGCCCGGCAAGGCCCACACGATCGAAACATCCAATCCACGGATCGATTCGAATTGCAACCCC

Click for details-----ITS1

GTGACCTGCGGAAGGATCATTGTTGATGCCCATCGAAACAAGACAGACGGAAAGCGAACTTGTGAACCCTGGTGTTCTTTGGCCCGCACGCCGGGCGGCGCTCAGCGCGTGTCGGGCAGCGACGAACCAAATCTCGGCGCAGGACGCGCCAAGCAACTCGGAAGCTTTGATTGCGGCGCCCTCTTCCCTGTCGGGATGGAGGGCGCGCATCGAACACTTACAAGTCAGTA

Click for details-----ITS2

AACTCGCCTCCCGCCGCCTTCCCCCTGCAGACTCGAGCGAGGGGCCTGTTGGAGATGAGGGTAGGTGGGGCGGAGTCTGGTCGTCCGTGTGCCTGCAGCGCATGCGGTTGGCTGAAAAGCCYGGGCCATGGGCTGCGTGCGGCTCAGCGAGTGGTGGTTGTGCGCCCTCGCAAGGCGGCGATTGTCGGCGCGTTGTGCCGTTCGCTCCCCGATTGCCCGGCAAGTACCCGACACCATCGAAAAATCCAATCCACGGATCGATTTGAATTTGCAACCCC
Taxonomic Information

Plant ID: NPO28928
Plant Latin Name: Piper Nigrum
Taxonomy Genus: Piper
Taxonomy Family: Piperaceae

Plant External Links:

NCBI TaxonomyDB: 13216
Plant-of-the-World-Online: 682369-1

Used in Medicines

Country/Region:
Brazil; Philippines; Indonesia; India; United States; China; Thailand; Iraq; Burkina Faso

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy

Geographical Distribution

Brazil; Bangladesh; Guinea; Costa Rica; Cambodia; Cameroon; Burkina Faso; Benin; Cuba; Venezuela; China; Thailand; Haiti; Iraq; Philippines; Indonesia; Mauritius; Trinidad and Tobago; French Guiana; Dominican Republic; United States; Seychelles; Honduras; Mexico; India; Sri Lanka

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

291 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


233 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

162 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99830

Ingredient ID: NPC99734

Ingredient ID: NPC99088

Ingredient ID: NPC96218

Ingredient ID: NPC95675

Ingredient ID: NPC94319

Ingredient ID: NPC94280

Ingredient ID: NPC9424

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC91574

Ingredient ID: NPC91051

Ingredient ID: NPC90105

Ingredient ID: NPC88759

Ingredient ID: NPC88566

Ingredient ID: NPC87566

Ingredient ID: NPC86939

Ingredient ID: NPC85813

Ingredient ID: NPC82704

Ingredient ID: NPC81500

Ingredient ID: NPC80090

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC76765

Ingredient ID: NPC76145

Ingredient ID: NPC7491

Ingredient ID: NPC73883

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC71105

Ingredient ID: NPC70869

Ingredient ID: NPC7057

Ingredient ID: NPC70383

Ingredient ID: NPC68898

Ingredient ID: NPC68889

Ingredient ID: NPC67761

Ingredient ID: NPC66577

Ingredient ID: NPC64370

Ingredient ID: NPC64176

Ingredient ID: NPC62045

Ingredient ID: NPC61769

Ingredient ID: NPC60288

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC57877

Ingredient ID: NPC55412

Ingredient ID: NPC53993

Ingredient ID: NPC53720

Ingredient ID: NPC51758

Ingredient ID: NPC51189

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489907

Ingredient ID: NPC48623

Ingredient ID: NPC48564

Ingredient ID: NPC470708

Ingredient ID: NPC470707

Ingredient ID: NPC470706

Ingredient ID: NPC470088

Ingredient ID: NPC469978

Ingredient ID: NPC469977

Ingredient ID: NPC469808

Ingredient ID: NPC46300

Ingredient ID: NPC45727

Ingredient ID: NPC45540

Ingredient ID: NPC43728

Ingredient ID: NPC43114

Ingredient ID: NPC42793

Ingredient ID: NPC424

Ingredient ID: NPC416184

Ingredient ID: NPC39068

Ingredient ID: NPC385

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC35519

Ingredient ID: NPC34764

Ingredient ID: NPC33991

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC313673

Ingredient ID: NPC31090

Ingredient ID: NPC310478

Ingredient ID: NPC308749

Ingredient ID: NPC307621

Ingredient ID: NPC305602

Ingredient ID: NPC304885

Ingredient ID: NPC302519

Ingredient ID: NPC302257

Ingredient ID: NPC301696

Ingredient ID: NPC300649

Ingredient ID: NPC297643

Ingredient ID: NPC297554

Ingredient ID: NPC296337

Ingredient ID: NPC295644

Ingredient ID: NPC294858

Ingredient ID: NPC294548

Ingredient ID: NPC294136

Ingredient ID: NPC292092

Ingredient ID: NPC291610

Ingredient ID: NPC291449

Ingredient ID: NPC290469

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC289366

Ingredient ID: NPC288932

Ingredient ID: NPC287660

Ingredient ID: NPC28641

Ingredient ID: NPC286240

Ingredient ID: NPC283170

Ingredient ID: NPC282694

Ingredient ID: NPC282305

Ingredient ID: NPC281915

Ingredient ID: NPC28190

Ingredient ID: NPC281686

Ingredient ID: NPC279865

Ingredient ID: NPC279026

Ingredient ID: NPC277907

Ingredient ID: NPC274584

Ingredient ID: NPC273023

Ingredient ID: NPC272614

Ingredient ID: NPC271087

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26974

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268564

Ingredient ID: NPC268375

Ingredient ID: NPC2660

Ingredient ID: NPC265605

Ingredient ID: NPC264779

Ingredient ID: NPC261831

Ingredient ID: NPC25771

Ingredient ID: NPC257124

Ingredient ID: NPC256848

Ingredient ID: NPC255817

Ingredient ID: NPC255577

Ingredient ID: NPC255555

Ingredient ID: NPC254156

Ingredient ID: NPC252107

Ingredient ID: NPC248726

Ingredient ID: NPC24784

Ingredient ID: NPC246543

Ingredient ID: NPC246165

Ingredient ID: NPC245858

Ingredient ID: NPC2426

Ingredient ID: NPC242580

Ingredient ID: NPC24216

Ingredient ID: NPC240817

Ingredient ID: NPC239406

Ingredient ID: NPC239039

Ingredient ID: NPC239037

Ingredient ID: NPC237812

Ingredient ID: NPC236579

Ingredient ID: NPC232375

Ingredient ID: NPC231884

Ingredient ID: NPC231738

Ingredient ID: NPC231

Ingredient ID: NPC230698

Ingredient ID: NPC229262

Ingredient ID: NPC227670

Ingredient ID: NPC227622

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225745

Ingredient ID: NPC22484

Ingredient ID: NPC223455

Ingredient ID: NPC22229

Ingredient ID: NPC222001

Ingredient ID: NPC220860

Ingredient ID: NPC219143

Ingredient ID: NPC218918

Ingredient ID: NPC217574

Ingredient ID: NPC216630

Ingredient ID: NPC2162

Ingredient ID: NPC215632

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC214036

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC210595

Ingredient ID: NPC209970

Ingredient ID: NPC209279

Ingredient ID: NPC209275

Ingredient ID: NPC208793

Ingredient ID: NPC208764

Ingredient ID: NPC208656

Ingredient ID: NPC207541

Ingredient ID: NPC206372

Ingredient ID: NPC205178

Ingredient ID: NPC203901

Ingredient ID: NPC203468

Ingredient ID: NPC202691

Ingredient ID: NPC202525

Ingredient ID: NPC201844

Ingredient ID: NPC200210

Ingredient ID: NPC198658

Ingredient ID: NPC195986

Ingredient ID: NPC194586

Ingredient ID: NPC194469

Ingredient ID: NPC19319

Ingredient ID: NPC193180

Ingredient ID: NPC190810

Ingredient ID: NPC189853

Ingredient ID: NPC189436

Ingredient ID: NPC188238

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC182571

Ingredient ID: NPC182570

Ingredient ID: NPC181718

Ingredient ID: NPC181048

Ingredient ID: NPC180871

Ingredient ID: NPC180647

Ingredient ID: NPC178209

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC176017

Ingredient ID: NPC175913

Ingredient ID: NPC175342

Ingredient ID: NPC175313

Ingredient ID: NPC17497

Ingredient ID: NPC174246

Ingredient ID: NPC172003

Ingredient ID: NPC170583

Ingredient ID: NPC170247

Ingredient ID: NPC1682

Ingredient ID: NPC167944

Ingredient ID: NPC167400

Ingredient ID: NPC166362

Ingredient ID: NPC164487

Ingredient ID: NPC161923

Ingredient ID: NPC16157

Ingredient ID: NPC161097

Ingredient ID: NPC16070

Ingredient ID: NPC157781

Ingredient ID: NPC157740

Ingredient ID: NPC155182

Ingredient ID: NPC154477

Ingredient ID: NPC15303

Ingredient ID: NPC152964

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC148478

Ingredient ID: NPC148303

Ingredient ID: NPC147983

Ingredient ID: NPC147247

Ingredient ID: NPC146197

Ingredient ID: NPC14576

Ingredient ID: NPC14426

Ingredient ID: NPC144023

Ingredient ID: NPC141777

Ingredient ID: NPC141739

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC13789

Ingredient ID: NPC13768

Ingredient ID: NPC136330

Ingredient ID: NPC136112

Ingredient ID: NPC136014

Ingredient ID: NPC134764

Ingredient ID: NPC131769

Ingredient ID: NPC131431

Ingredient ID: NPC130683

Ingredient ID: NPC12845

Ingredient ID: NPC127122

Ingredient ID: NPC126681

Ingredient ID: NPC124876

Ingredient ID: NPC122487

Ingredient ID: NPC120926

Ingredient ID: NPC120066

Ingredient ID: NPC118885

Ingredient ID: NPC118429

Ingredient ID: NPC114992

Ingredient ID: NPC11433

Ingredient ID: NPC114239

Ingredient ID: NPC112890

Ingredient ID: NPC109813

Ingredient ID: NPC108494

Ingredient ID: NPC107657

Ingredient ID: NPC106250

Ingredient ID: NPC105585

Ingredient ID: NPC103700

Ingredient ID: NPC101285

Ingredient ID: NPC100879

Ingredient ID: NPC100082