CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Calendula Officinalis

Example Image

PLANiTS DNA barcode

TCGAACCCTGCACAGCAGAATGACCCGTGAACATGTACTAACAACCGGGCGTCGTTTGGAYGGGGTCTCGTTTCCTGTCCTTGCGCCGCCCTGTCGGTGTGCGTGCTTGTTGGCCCGTTCTCGGGCCTTGAGCGCGTCGCGCCGGCACAACAACAAACCCCGGCACGCACGTGCCAAGGAATACTAAACCTAAGAAGGGCTCGCAGCCCGATGCCCCGTTCGCGGTGTGCTCTTGCTGCGTGGCCTCTTTTTGTGAATCACAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCACCAMACATCCCTTTTGGCGATSCCTGGTGCGGGGGCGGAGATTGGCCTCCCGTTCCAAYGGCGCGGTTGGCCAAAAACTGAGTCCCCTTCGGTGGACGCACGRCAAGTGGTGGTTGATAAAACTCTCGTCTCGTGTCGTGCGTTCTAAGCATCGATGGGCTAGCTCTCCAAAGACCCCAACGTGTCGTCTCGCGACGATGCTTCGACC

Taxonomic Information

Plant ID: NPO28919
Plant Latin Name: Calendula Officinalis
Taxonomy Genus: Calendula
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 41496
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Turkey; Italy; India; China; Russia; Spain

Traditional Medicine System:

Indian Folk; TCM; Homeopathy

Medicinal Functions:

Antiphlogistic; Antiseptic; Antispasmodic; Aperient; Astringent; Cholagogue; Diaphoretic; Emmenagogue; Homeopathy; Skin; Stimulant; Vulnerary; Warts

Geographical Distribution

Turkey; Italy; India; China; Russia; Spain

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

41 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

5 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

21 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC89978

Ingredient ID: NPC89052

Ingredient ID: NPC86222

Ingredient ID: NPC80986

Ingredient ID: NPC62725

Ingredient ID: NPC39211

Ingredient ID: NPC35405

Ingredient ID: NPC294815

Ingredient ID: NPC286347

Ingredient ID: NPC283222

Ingredient ID: NPC270280

Ingredient ID: NPC261038

Ingredient ID: NPC25407

Ingredient ID: NPC253807

Ingredient ID: NPC236870

Ingredient ID: NPC22956

Ingredient ID: NPC225434

Ingredient ID: NPC223301

Ingredient ID: NPC222781

Ingredient ID: NPC220173

Ingredient ID: NPC217520

Ingredient ID: NPC211913

Ingredient ID: NPC193585

Ingredient ID: NPC183993

Ingredient ID: NPC183815

Ingredient ID: NPC179950

Ingredient ID: NPC1777

Ingredient ID: NPC176740

Ingredient ID: NPC174660

Ingredient ID: NPC173592

Ingredient ID: NPC148756

Ingredient ID: NPC13115

Ingredient ID: NPC126004

Ingredient ID: NPC124893

Ingredient ID: NPC116990

Ingredient ID: NPC114318

Ingredient ID: NPC111350

Ingredient ID: NPC109867

Ingredient ID: NPC109813

Ingredient ID: NPC10607

Ingredient ID: NPC104372

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Small molecule receptor (family A GPCR)	CNR2	Cannabinoid CB2 receptor	P34972	CHEMBL253

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	8

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01705652	Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients	prostate cancer	Rutin (NPC176740)	NP level
NCT04733651	Study to Investigate the Clinical Efficacy of Isoquercetin in Patients With COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT02552888	Nitrite, Isoquercetin and Endothelial Dysfunction (NICE) Trial	chronic kidney disease	Isoquercetin (NPC179950)	NP level
NCT04474626	Isoquercetin in Sickle Cell Anemia	sickle cell anemia	Isoquercetin (NPC179950)	NP level
NCT04622865	Masitinib Combined With Isoquercetin and Best Supportive Care in Hospitalized Patients With Moderate and Severe COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT02446795	Isoquercetin as an Adjunct Therapy in Patients With Kidney Cancer Receiving First-line Sunitinib: a Phase I/II Trial	renal cell carcinoma	Isoquercetin (NPC179950)	NP level
NCT04536090	Study of Isoquercetin (IQC-950AN) Plus Standard of Care Versus Standard of Care Only for the Treatment of COVID-19	COVID-19	Isoquercetin (NPC179950)	NP level
NCT04514510	Fixed Dose Flavonoid Isoquercetin on Thrombo-Inflammatory Biomarkers in Subjects With Stable Sickle Cell Disease	sickle cell anemia	Isoquercetin (NPC179950)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA12,CA4,KDM1A,CA2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	KDM1A,CNR2,ACHE,CA12
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CNR2,ACHE,CA2,CA7
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,CNR2,ACHE,CA4
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA4,CA12,CA2
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA2,CA4,CA12
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA2,CA12,CA4
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA4,CA2,ACHE
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04536090,NCT04733651,NCT04622865
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA2,CA7,KDM1A
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA2,ACHE,CA4
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,CNR2,CA7
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CA4,CA12
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	CA2,ACHE,CA4
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA2,CNR2,ACHE
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,ACHE,CA7
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,CA7,CA4
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2,CNR2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE,CNR2
Sickle-cell disorder Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A51	NCT04514510,NCT04474626
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA2,CA12
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12,CA4
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,CA7
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,CA7
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CNR2,ACHE
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CNR2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA2,CA12
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA2,CA12
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	KDM1A
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	CNR2
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Ewing sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B52	KDM1A
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	CNR2
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	KDM1A
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	ACHE
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	KDM1A
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	KDM1A
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	CNR2
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDM1A
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDM1A
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CA4
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	CNR2
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	CNR2
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	NCT02552888
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	NCT02446795
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NCT01705652
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CA4
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	CNR2
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA4
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA4
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA2
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA2
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	CNR2
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Calendula Officinalis

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

41 All known Ingredients in Total

5 Ingredients with Acceptable Bioavailablity

21 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Solid tumour/cancer

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Germ cell tumour of testis

Breast cancer

Seborrhoeic dermatitis

Bacterial infection

Glaucoma

COVID-19

Carcinosarcoma of uterus

Pheochromocytoma

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Superficial ovarian endometriosis

Cytomegaloviral disease

Adenocarcinoma of bronchus or lung

Malignant neoplasms of adrenal gland

Insomnia

Pain, unspecified

Sickle-cell disorder

Serous cystadenoma,borderline malignancy of ovary

Hepatoblastoma

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of thymus

Invasive carcinoma of breast

Glioblastoma of brain

Renal cell carcinoma, chromophobe type

Duodenal ulcer

Malignant haematopoietic neoplasm

Inborn lipid metabolism error

Mild neurocognitive disorder

Ewing sarcoma

Essential hypertension

Crohn disease

Dementia

Mature T-cell lymphoma

Parasitic worm infestation

Parkinsonism

Alzheimer disease

Low bone mass disorder

Myeloproliferative neoplasm

Substance abuse

Unspecific substance harmful effect

Rheumatoid arthritis

Myasthenia gravis

Pediculosis

Acute myeloid leukaemia

General pain disorder

Myelodysplastic syndrome

Lung cancer

Asthma

Atopic eczema

Attention deficit hyperactivity disorder

Oesophageal/gastroduodenal disorder

Heart failure

Chronic kidney disease

Renal cell carcinoma

Prostate cancer

Zika virus disease

Osteoarthritis, unspecified